Incidental Mutation 'R3723:Api5'
ID270618
Institutional Source Beutler Lab
Gene Symbol Api5
Ensembl Gene ENSMUSG00000027193
Gene Nameapoptosis inhibitor 5
SynonymsAAC-11
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location94411682-94438136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94425613 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 243 (R243Q)
Ref Sequence ENSEMBL: ENSMUSP00000028617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028617
AA Change: R243Q

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028617
Gene: ENSMUSG00000027193
AA Change: R243Q

DomainStartEndE-ValueType
Pfam:API5 4 504 8.9e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152454
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an apoptosis inhibitory protein whose expression prevents apoptosis after growth factor deprivation. This protein suppresses the transcription factor E2F1-induced apoptosis and also interacts with, and negatively regulates Acinus, a nuclear factor involved in apoptotic DNA fragmentation. Its depletion enhances the cytotoxic action of the chemotherapeutic drugs. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Api5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Api5 APN 2 94418954 splice site probably benign
IGL02203:Api5 APN 2 94425074 missense probably benign 0.00
IGL02346:Api5 APN 2 94427530 missense possibly damaging 0.77
IGL02605:Api5 APN 2 94429719 missense possibly damaging 0.88
IGL02646:Api5 APN 2 94429839 missense possibly damaging 0.62
R0018:Api5 UTSW 2 94420984 critical splice donor site probably null
R0149:Api5 UTSW 2 94423497 nonsense probably null
R0361:Api5 UTSW 2 94423497 nonsense probably null
R1554:Api5 UTSW 2 94425643 missense probably benign 0.14
R2507:Api5 UTSW 2 94429817 missense probably damaging 1.00
R3724:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3737:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3738:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4035:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4724:Api5 UTSW 2 94423471 missense possibly damaging 0.95
R5306:Api5 UTSW 2 94423466 nonsense probably null
R5337:Api5 UTSW 2 94425688 missense possibly damaging 0.94
R6577:Api5 UTSW 2 94422381 missense probably benign 0.24
R7031:Api5 UTSW 2 94425616 missense probably benign 0.01
R7936:Api5 UTSW 2 94438047 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTCTTGCTGCCTTGGG -3'
(R):5'- AAATGCTGTTCTTCTCGATTGCG -3'

Sequencing Primer
(F):5'- TGGGTTCTTCCAGTGCCGC -3'
(R):5'- TTCTAGGTCCTAGAAGACGTGAC -3'
Posted On2015-03-18