Incidental Mutation 'R3723:Srsf4'
ID270621
Institutional Source Beutler Lab
Gene Symbol Srsf4
Ensembl Gene ENSMUSG00000028911
Gene Nameserine/arginine-rich splicing factor 4
SynonymsMNCb-2616, Sfrs4, SRp75, 5730499P16Rik
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R3723 (G1)
Quality Score170
Status Validated
Chromosome4
Chromosomal Location131873617-131901706 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 131900102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053819] [ENSMUST00000134943]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030743
SMART Domains Protein: ENSMUSP00000030743
Gene: ENSMUSG00000028911

DomainStartEndE-ValueType
RRM 14 73 1.09e0 SMART
low complexity region 76 102 N/A INTRINSIC
RRM 110 178 2e-14 SMART
low complexity region 184 277 N/A INTRINSIC
low complexity region 304 328 N/A INTRINSIC
low complexity region 329 408 N/A INTRINSIC
low complexity region 460 496 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000053819
AA Change: R207W
SMART Domains Protein: ENSMUSP00000061474
Gene: ENSMUSG00000028911
AA Change: R207W

DomainStartEndE-ValueType
RRM 3 68 4.3e-21 SMART
low complexity region 71 97 N/A INTRINSIC
RRM 105 173 8.4e-17 SMART
low complexity region 179 272 N/A INTRINSIC
low complexity region 299 323 N/A INTRINSIC
low complexity region 324 403 N/A INTRINSIC
low complexity region 455 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000134943
Meta Mutation Damage Score 0.1502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Srsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Srsf4 UTSW 4 131900330 unclassified probably benign
R1135:Srsf4 UTSW 4 131900069 unclassified probably benign
R1209:Srsf4 UTSW 4 131901059 unclassified probably benign
R1276:Srsf4 UTSW 4 131897685 missense probably damaging 1.00
R1561:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1574:Srsf4 UTSW 4 131897695 missense probably damaging 1.00
R1700:Srsf4 UTSW 4 131900560 unclassified probably benign
R2265:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R2269:Srsf4 UTSW 4 131897682 missense probably damaging 1.00
R3724:Srsf4 UTSW 4 131900102 unclassified probably benign
R3737:Srsf4 UTSW 4 131900102 unclassified probably benign
R3738:Srsf4 UTSW 4 131900102 unclassified probably benign
R3739:Srsf4 UTSW 4 131900102 unclassified probably benign
R4034:Srsf4 UTSW 4 131900102 unclassified probably benign
R4035:Srsf4 UTSW 4 131900102 unclassified probably benign
R4049:Srsf4 UTSW 4 131900543 unclassified probably benign
R4535:Srsf4 UTSW 4 131873864 missense probably damaging 1.00
R4810:Srsf4 UTSW 4 131900102 unclassified probably benign
R4833:Srsf4 UTSW 4 131900102 unclassified probably benign
R4932:Srsf4 UTSW 4 131891245 missense probably damaging 0.99
R5291:Srsf4 UTSW 4 131886306 critical splice donor site probably benign
R5725:Srsf4 UTSW 4 131900951 unclassified probably benign
R6145:Srsf4 UTSW 4 131900294 unclassified probably benign
R7056:Srsf4 UTSW 4 131900693 unclassified probably benign
R7294:Srsf4 UTSW 4 131900461 missense unknown
R7964:Srsf4 UTSW 4 131891233 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAAACCCCTTACAGGCAATTTAAATTG -3'
(R):5'- CTTACTGCGGCTCTTGTCAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGGGCTCAAGAAGTCG -3'
(R):5'- GCTCTGACTGCGACTGC -3'
Posted On2015-03-18