Incidental Mutation 'R3723:Rere'
ID 270623
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Name arginine glutamic acid dipeptide (RE) repeats
Synonyms eye, eyes3, Atr2, atrophin-2, 1110033A15Rik
MMRRC Submission 040714-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3723 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 150366103-150706423 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 150553252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 148 (E148G)
Ref Sequence ENSEMBL: ENSMUSP00000115385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105682] [ENSMUST00000131600]
AlphaFold Q80TZ9
Predicted Effect unknown
Transcript: ENSMUST00000105682
AA Change: E208G
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: E208G

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131600
AA Change: E148G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115385
Gene: ENSMUSG00000039852
AA Change: E148G

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 34 47 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Pfam:BAH 85 178 2.1e-9 PFAM
Meta Mutation Damage Score 0.3852 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,994,217 (GRCm39) V5167A possibly damaging Het
Ano5 A G 7: 51,226,276 (GRCm39) Y510C probably damaging Het
Api5 C T 2: 94,255,958 (GRCm39) R243Q possibly damaging Het
Apob A T 12: 8,056,327 (GRCm39) Q1570L probably damaging Het
Apob A G 12: 8,061,763 (GRCm39) N3415S possibly damaging Het
Arsk T A 13: 76,214,772 (GRCm39) I361F probably damaging Het
C9 G A 15: 6,512,561 (GRCm39) E228K possibly damaging Het
Celsr2 A G 3: 108,304,731 (GRCm39) probably benign Het
Cfap53 A G 18: 74,492,640 (GRCm39) I455V probably benign Het
Ckap4 A G 10: 84,364,256 (GRCm39) L269P probably damaging Het
Dnah7a T A 1: 53,486,505 (GRCm39) D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 (GRCm39) M3335K probably benign Het
Fam171a1 A G 2: 3,221,412 (GRCm39) probably benign Het
Glis3 A T 19: 28,239,991 (GRCm39) C97* probably null Het
Gm14221 C G 2: 160,410,347 (GRCm39) noncoding transcript Het
Gm8603 A C 17: 13,737,075 (GRCm39) probably null Het
Gm9767 G T 10: 25,954,469 (GRCm39) probably benign Het
Kctd16 A G 18: 40,391,912 (GRCm39) T167A possibly damaging Het
Kif18b A G 11: 102,807,102 (GRCm39) F78L probably damaging Het
Mefv A G 16: 3,526,058 (GRCm39) probably null Het
Mipol1 C A 12: 57,503,878 (GRCm39) L349I probably damaging Het
Myo10 T C 15: 25,803,374 (GRCm39) V1527A probably damaging Het
Naip5 G T 13: 100,359,522 (GRCm39) Y571* probably null Het
Npl A G 1: 153,391,210 (GRCm39) F182L probably benign Het
Pan3 T A 5: 147,440,018 (GRCm39) probably benign Het
Pcdh15 A T 10: 74,481,680 (GRCm39) T342S probably benign Het
Pcdhga1 A G 18: 37,796,045 (GRCm39) T350A possibly damaging Het
Pramel28 T C 4: 143,693,251 (GRCm39) T76A probably benign Het
Prdm4 A G 10: 85,735,145 (GRCm39) S666P probably damaging Het
Scube2 T C 7: 109,407,613 (GRCm39) probably benign Het
Sptbn1 A G 11: 30,087,335 (GRCm39) S1035P possibly damaging Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
Supt3 A G 17: 45,305,274 (GRCm39) D108G probably damaging Het
Tnfsf13b A G 8: 10,081,545 (GRCm39) I236V possibly damaging Het
Tns1 T C 1: 73,964,099 (GRCm39) S1511G probably damaging Het
Tpm1 G A 9: 66,939,227 (GRCm39) probably benign Het
Uba6 T C 5: 86,282,906 (GRCm39) D559G probably damaging Het
Vmn1r117 T A 7: 20,617,380 (GRCm39) I223F probably damaging Het
Vmn2r91 G A 17: 18,305,540 (GRCm39) probably null Het
Zfp30 A G 7: 29,492,778 (GRCm39) E344G probably damaging Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150,703,920 (GRCm39) missense probably damaging 1.00
IGL01465:Rere APN 4 150,594,451 (GRCm39) missense unknown
IGL01523:Rere APN 4 150,700,012 (GRCm39) missense possibly damaging 0.93
IGL01688:Rere APN 4 150,702,893 (GRCm39) missense probably damaging 1.00
IGL02057:Rere APN 4 150,699,289 (GRCm39) unclassified probably benign
IGL02621:Rere APN 4 150,698,269 (GRCm39) unclassified probably benign
IGL02672:Rere APN 4 150,594,483 (GRCm39) missense unknown
R0116:Rere UTSW 4 150,701,433 (GRCm39) missense probably benign 0.18
R0119:Rere UTSW 4 150,699,779 (GRCm39) unclassified probably benign
R0344:Rere UTSW 4 150,695,438 (GRCm39) unclassified probably benign
R0504:Rere UTSW 4 150,699,779 (GRCm39) unclassified probably benign
R0630:Rere UTSW 4 150,703,545 (GRCm39) missense probably damaging 1.00
R0961:Rere UTSW 4 150,699,829 (GRCm39) unclassified probably benign
R1164:Rere UTSW 4 150,619,341 (GRCm39) missense unknown
R1424:Rere UTSW 4 150,701,495 (GRCm39) missense probably damaging 1.00
R1542:Rere UTSW 4 150,700,399 (GRCm39) missense probably damaging 1.00
R1652:Rere UTSW 4 150,696,522 (GRCm39) unclassified probably benign
R1953:Rere UTSW 4 150,701,294 (GRCm39) missense probably damaging 1.00
R1959:Rere UTSW 4 150,553,247 (GRCm39) missense probably benign 0.23
R1966:Rere UTSW 4 150,701,330 (GRCm39) missense probably damaging 1.00
R1975:Rere UTSW 4 150,700,190 (GRCm39) missense probably damaging 0.99
R2070:Rere UTSW 4 150,699,047 (GRCm39) unclassified probably benign
R2115:Rere UTSW 4 150,697,018 (GRCm39) unclassified probably benign
R2144:Rere UTSW 4 150,701,388 (GRCm39) missense probably damaging 0.99
R2270:Rere UTSW 4 150,561,837 (GRCm39) missense unknown
R2969:Rere UTSW 4 150,654,673 (GRCm39) missense unknown
R3699:Rere UTSW 4 150,561,819 (GRCm39) critical splice acceptor site probably null
R3826:Rere UTSW 4 150,554,785 (GRCm39) missense probably benign 0.42
R4234:Rere UTSW 4 150,701,862 (GRCm39) missense probably damaging 1.00
R4512:Rere UTSW 4 150,561,909 (GRCm39) missense unknown
R4798:Rere UTSW 4 150,699,624 (GRCm39) unclassified probably benign
R4883:Rere UTSW 4 150,700,510 (GRCm39) missense probably damaging 0.98
R4914:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4916:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4917:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4918:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4966:Rere UTSW 4 150,698,273 (GRCm39) unclassified probably benign
R5172:Rere UTSW 4 150,654,726 (GRCm39) missense unknown
R5643:Rere UTSW 4 150,701,700 (GRCm39) missense probably damaging 1.00
R6058:Rere UTSW 4 150,553,255 (GRCm39) missense probably damaging 1.00
R7112:Rere UTSW 4 150,491,061 (GRCm39) missense probably benign
R7173:Rere UTSW 4 150,553,195 (GRCm39) missense probably damaging 1.00
R7190:Rere UTSW 4 150,695,410 (GRCm39) missense unknown
R7699:Rere UTSW 4 150,701,555 (GRCm39) missense
R7990:Rere UTSW 4 150,699,327 (GRCm39) missense unknown
R8070:Rere UTSW 4 150,701,832 (GRCm39) missense probably damaging 1.00
R8101:Rere UTSW 4 150,701,796 (GRCm39) missense probably damaging 1.00
R8103:Rere UTSW 4 150,701,796 (GRCm39) missense probably damaging 1.00
R8215:Rere UTSW 4 150,701,424 (GRCm39) missense possibly damaging 0.95
R8254:Rere UTSW 4 150,697,129 (GRCm39) missense unknown
R8348:Rere UTSW 4 150,703,653 (GRCm39) missense probably damaging 1.00
R8448:Rere UTSW 4 150,703,653 (GRCm39) missense probably damaging 1.00
R8725:Rere UTSW 4 150,701,792 (GRCm39) nonsense probably null
R8790:Rere UTSW 4 150,593,332 (GRCm39) missense unknown
R8921:Rere UTSW 4 150,696,471 (GRCm39) missense unknown
R8937:Rere UTSW 4 150,699,331 (GRCm39) unclassified probably benign
R9345:Rere UTSW 4 150,554,770 (GRCm39) missense probably damaging 0.99
R9377:Rere UTSW 4 150,593,342 (GRCm39) missense unknown
R9490:Rere UTSW 4 150,516,040 (GRCm39) missense probably benign 0.16
R9523:Rere UTSW 4 150,703,636 (GRCm39) missense probably damaging 0.98
R9653:Rere UTSW 4 150,516,010 (GRCm39) missense probably benign 0.28
R9657:Rere UTSW 4 150,699,390 (GRCm39) missense unknown
Z1176:Rere UTSW 4 150,553,240 (GRCm39) missense probably damaging 1.00
Z1177:Rere UTSW 4 150,700,268 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CGTAGGTATGATGTGCACTTGC -3'
(R):5'- GGTCAAACACAGGAGCTTCAAG -3'

Sequencing Primer
(F):5'- TTGCAGGCACCTGAAACCTG -3'
(R):5'- TGCATCCATGTAGGCTACAG -3'
Posted On 2015-03-18