Incidental Mutation 'R3723:Pan3'
ID270626
Institutional Source Beutler Lab
Gene Symbol Pan3
Ensembl Gene ENSMUSG00000029647
Gene NamePAN3 poly(A) specific ribonuclease subunit
Synonyms2700050F09Rik, A430027N15Rik
MMRRC Submission 040714-MU
Accession Numbers

Genbank: NM_028291.4; Ensembl: ENSMUST00000031651

Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147430161-147548502 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 147503208 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031651] [ENSMUST00000176600]
Predicted Effect probably benign
Transcript: ENSMUST00000031651
SMART Domains Protein: ENSMUSP00000031651
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
PDB:4BWP|B 391 829 1e-161 PDB
Blast:S_TKc 439 607 2e-8 BLAST
SCOP:d1pme__ 453 602 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176466
Predicted Effect probably benign
Transcript: ENSMUST00000176596
Predicted Effect probably benign
Transcript: ENSMUST00000176600
SMART Domains Protein: ENSMUSP00000135367
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 3 50 N/A INTRINSIC
ZnF_C3H1 51 76 2.24e-3 SMART
low complexity region 77 87 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 188 194 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
PDB:4BWP|B 445 883 1e-161 PDB
Blast:S_TKc 493 661 2e-8 BLAST
SCOP:d1pme__ 507 656 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176753
SMART Domains Protein: ENSMUSP00000134989
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
low complexity region 173 190 N/A INTRINSIC
PDB:4BWP|B 246 684 1e-164 PDB
Blast:S_TKc 294 462 1e-8 BLAST
SCOP:d1pme__ 308 457 8e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177465
SMART Domains Protein: ENSMUSP00000134810
Gene: ENSMUSG00000029647

DomainStartEndE-ValueType
low complexity region 43 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200885
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
Allele List at MGI

 All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Pan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Pan3 APN 5 147529973 missense probably benign 0.05
IGL01612:Pan3 APN 5 147453242 splice site probably benign
IGL02187:Pan3 APN 5 147526588 missense probably benign 0.21
IGL02324:Pan3 APN 5 147530123 splice site probably null
IGL02328:Pan3 APN 5 147530123 splice site probably null
IGL02507:Pan3 APN 5 147526596 missense probably damaging 0.98
IGL03144:Pan3 APN 5 147450781 splice site probably benign
3-1:Pan3 UTSW 5 147526575 missense probably benign 0.14
R2145:Pan3 UTSW 5 147530098 missense possibly damaging 0.87
R2174:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R2504:Pan3 UTSW 5 147527036 missense possibly damaging 0.87
R3106:Pan3 UTSW 5 147539379 splice site probably benign
R3944:Pan3 UTSW 5 147450730 missense probably damaging 1.00
R4589:Pan3 UTSW 5 147543173 missense probably damaging 0.98
R4647:Pan3 UTSW 5 147527203 missense probably damaging 1.00
R4811:Pan3 UTSW 5 147530058 missense probably damaging 1.00
R5001:Pan3 UTSW 5 147526682 critical splice donor site probably null
R5126:Pan3 UTSW 5 147527198 missense probably benign 0.00
R5215:Pan3 UTSW 5 147455105 splice site probably null
R5317:Pan3 UTSW 5 147543210 critical splice donor site probably null
R5496:Pan3 UTSW 5 147527128 critical splice acceptor site probably null
R5687:Pan3 UTSW 5 147455172 missense probably damaging 1.00
R6147:Pan3 UTSW 5 147548283 unclassified probably benign
R6539:Pan3 UTSW 5 147450653 missense possibly damaging 0.63
R7008:Pan3 UTSW 5 147545693 missense probably damaging 0.99
R7047:Pan3 UTSW 5 147546365 missense probably damaging 0.97
R7226:Pan3 UTSW 5 147526992 missense probably damaging 1.00
R7424:Pan3 UTSW 5 147536272 splice site probably null
R7453:Pan3 UTSW 5 147526681 critical splice donor site probably null
R8062:Pan3 UTSW 5 147527150 missense probably benign 0.18
X0060:Pan3 UTSW 5 147543133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTTGAAAGAGCCTATGAGC -3'
(R):5'- GCAAATACCCTATGCTGACCG -3'

Sequencing Primer
(F):5'- TTGAAAGAGCCTATGAGCAGTAGC -3'
(R):5'- TATGCTGACCGCTCAGGACATAC -3'
Posted On2015-03-18