Incidental Mutation 'R3723:Zfp30'
ID270628
Institutional Source Beutler Lab
Gene Symbol Zfp30
Ensembl Gene ENSMUSG00000047473
Gene Namezinc finger protein 30
SynonymsZfp-30, 2610306P15Rik
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29783998-29794702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29793353 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 344 (E344G)
Ref Sequence ENSEMBL: ENSMUSP00000113426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032803] [ENSMUST00000122387]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032803
AA Change: E425G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032803
Gene: ENSMUSG00000047473
AA Change: E425G

DomainStartEndE-ValueType
KRAB 21 82 4.61e-37 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 7.78e-3 SMART
ZnF_C2H2 243 265 5.06e-2 SMART
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 319 3.72e0 SMART
ZnF_C2H2 327 349 3.24e0 SMART
ZnF_C2H2 355 377 3.89e-3 SMART
ZnF_C2H2 383 405 4.79e-3 SMART
ZnF_C2H2 411 433 1.36e-2 SMART
ZnF_C2H2 439 461 1.36e-2 SMART
ZnF_C2H2 467 489 7.26e-3 SMART
ZnF_C2H2 495 517 2.09e-3 SMART
ZnF_C2H2 523 545 6.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122387
AA Change: E344G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113426
Gene: ENSMUSG00000047473
AA Change: E344G

DomainStartEndE-ValueType
ZnF_C2H2 106 128 5.9e-3 SMART
ZnF_C2H2 134 156 7.78e-3 SMART
ZnF_C2H2 162 184 5.06e-2 SMART
ZnF_C2H2 190 212 1.47e-3 SMART
ZnF_C2H2 218 238 3.72e0 SMART
ZnF_C2H2 246 268 3.24e0 SMART
ZnF_C2H2 274 296 3.89e-3 SMART
ZnF_C2H2 302 324 4.79e-3 SMART
ZnF_C2H2 330 352 1.36e-2 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 386 408 7.26e-3 SMART
ZnF_C2H2 414 436 2.09e-3 SMART
ZnF_C2H2 442 464 6.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126504
Meta Mutation Damage Score 0.1085 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Other mutations in Zfp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
elo UTSW 7 29793066 nonsense probably null
R0022:Zfp30 UTSW 7 29792435 missense possibly damaging 0.68
R0218:Zfp30 UTSW 7 29793638 missense probably damaging 1.00
R0349:Zfp30 UTSW 7 29793604 missense probably damaging 1.00
R0537:Zfp30 UTSW 7 29792735 missense probably damaging 0.98
R0653:Zfp30 UTSW 7 29792753 missense probably damaging 1.00
R1836:Zfp30 UTSW 7 29793380 missense probably damaging 0.96
R1966:Zfp30 UTSW 7 29792452 missense probably benign
R2100:Zfp30 UTSW 7 29793526 missense probably benign 0.30
R3696:Zfp30 UTSW 7 29793390 missense probably damaging 1.00
R4571:Zfp30 UTSW 7 29793202 missense probably damaging 1.00
R5027:Zfp30 UTSW 7 29793066 nonsense probably null
R5070:Zfp30 UTSW 7 29786266 utr 5 prime probably benign
R6013:Zfp30 UTSW 7 29789421 missense possibly damaging 0.79
R7274:Zfp30 UTSW 7 29792618 missense probably benign
R7484:Zfp30 UTSW 7 29792806 missense probably benign 0.01
R8181:Zfp30 UTSW 7 29793655 missense probably benign 0.03
R8255:Zfp30 UTSW 7 29789401 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACGACTGCAAGGAGTGTGG -3'
(R):5'- TGCAAGGCAAGGATTCGTAG -3'

Sequencing Primer
(F):5'- AAGGCGTTCCGGGTGAG -3'
(R):5'- GTTGACGGAAGGCCTTCTTACAC -3'
Posted On2015-03-18