Mutagenetix > Incidental Mutations

Incidental Mutation 'R3723:Ano5'

270629

Institutional Source

Beutler Lab

Gene Symbol

Ano5

Ensembl Gene

ENSMUSG00000055489

Gene Name

anoctamin 5

Synonyms

Gdd1, Tmem16e

MMRRC Submission

040714-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R3723 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51511029-51598709 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51576528 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 510 (Y510C)

Ref Sequence

ENSEMBL: ENSMUSP00000147243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043944
AA Change: Y543C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489
AA Change: Y543C

Domain	Start	End	E-Value	Type
low complexity region	42	55	N/A	INTRINSIC
Pfam:Anoct_dimer	64	280	7.7e-70	PFAM
Pfam:Anoctamin	283	860	6.5e-138	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000207044
AA Change: Y510C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000207717

Meta Mutation Damage Score

0.3063

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

95% (38/40)

MGI Phenotype

FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	T	C	19: 9,016,853	V5167A	possibly damaging	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Apob	A	T	12: 8,006,327	Q1570L	probably damaging	Het
Apob	A	G	12: 8,011,763	N3415S	possibly damaging	Het
Arsk	T	A	13: 76,066,653	I361F	probably damaging	Het
C9	G	A	15: 6,483,080	E228K	possibly damaging	Het
Celsr2	A	G	3: 108,397,415		probably benign	Het
Cfap53	A	G	18: 74,359,569	I455V	probably benign	Het
Ckap4	A	G	10: 84,528,392	L269P	probably damaging	Het
Dnah7a	T	A	1: 53,447,346	D3352V	probably benign	Het
Dync2h1	A	T	9: 7,041,658	M3335K	probably benign	Het
Fam171a1	A	G	2: 3,220,375		probably benign	Het
Glis3	A	T	19: 28,262,591	C97*	probably null	Het
Gm13101	T	C	4: 143,966,681	T76A	probably benign	Het
Gm14221	C	G	2: 160,568,427		noncoding transcript	Het
Gm8603	A	C	17: 13,516,813		probably null	Het
Gm9767	G	T	10: 26,078,571		probably benign	Het
Kctd16	A	G	18: 40,258,859	T167A	possibly damaging	Het
Kif18b	A	G	11: 102,916,276	F78L	probably damaging	Het
Mefv	A	G	16: 3,708,194		probably null	Het
Mipol1	C	A	12: 57,457,092	L349I	probably damaging	Het
Myo10	T	C	15: 25,803,288	V1527A	probably damaging	Het
Naip5	G	T	13: 100,223,014	Y571*	probably null	Het
Npl	A	G	1: 153,515,464	F182L	probably benign	Het
Pan3	T	A	5: 147,503,208		probably benign	Het
Pcdh15	A	T	10: 74,645,848	T342S	probably benign	Het
Pcdhga1	A	G	18: 37,662,992	T350A	possibly damaging	Het
Prdm4	A	G	10: 85,899,281	S666P	probably damaging	Het
Rere	A	G	4: 150,468,795	E148G	probably damaging	Het
Scube2	T	C	7: 109,808,406		probably benign	Het
Sptbn1	A	G	11: 30,137,335	S1035P	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Supt3	A	G	17: 44,994,387	D108G	probably damaging	Het
Tnfsf13b	A	G	8: 10,031,545	I236V	possibly damaging	Het
Tns1	T	C	1: 73,924,940	S1511G	probably damaging	Het
Tpm1	G	A	9: 67,031,945		probably benign	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Vmn1r117	T	A	7: 20,883,455	I223F	probably damaging	Het
Vmn2r91	G	A	17: 18,085,278		probably null	Het
Zfp30	A	G	7: 29,793,353	E344G	probably damaging	Het

Other mutations in Ano5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Ano5	APN	7	51566513	missense	probably damaging	0.96
IGL01328:Ano5	APN	7	51556271	critical splice donor site	probably null
IGL01800:Ano5	APN	7	51573075	critical splice donor site	probably null
IGL01888:Ano5	APN	7	51566300	missense	probably benign	0.06
IGL02221:Ano5	APN	7	51570323	missense	probably damaging	1.00
IGL02538:Ano5	APN	7	51583775	missense	probably damaging	1.00
IGL03027:Ano5	APN	7	51566277	missense	probably damaging	0.99
IGL03133:Ano5	APN	7	51576512	nonsense	probably null
IGL03167:Ano5	APN	7	51585511	missense	probably damaging	0.98
IGL03233:Ano5	APN	7	51570368	missense	probably damaging	1.00
PIT4466001:Ano5	UTSW	7	51544851	missense	probably damaging	1.00
R0233:Ano5	UTSW	7	51535470	missense	possibly damaging	0.94
R0233:Ano5	UTSW	7	51535470	missense	possibly damaging	0.94
R0675:Ano5	UTSW	7	51574810	missense	probably damaging	1.00
R0723:Ano5	UTSW	7	51587758	missense	probably benign	0.20
R0764:Ano5	UTSW	7	51537842	splice site	probably benign
R1159:Ano5	UTSW	7	51579474	splice site	probably benign
R1218:Ano5	UTSW	7	51570421	splice site	probably null
R1288:Ano5	UTSW	7	51546872	missense	probably damaging	1.00
R1329:Ano5	UTSW	7	51546785	missense	probably benign
R1484:Ano5	UTSW	7	51566320	missense	probably damaging	1.00
R1496:Ano5	UTSW	7	51583775	missense	probably damaging	1.00
R1512:Ano5	UTSW	7	51579568	missense	probably benign	0.00
R1691:Ano5	UTSW	7	51590579	missense	probably damaging	1.00
R1859:Ano5	UTSW	7	51546833	missense	probably damaging	1.00
R1991:Ano5	UTSW	7	51537813	missense	possibly damaging	0.59
R2066:Ano5	UTSW	7	51585386	missense	probably damaging	1.00
R2088:Ano5	UTSW	7	51587706	missense	possibly damaging	0.50
R2103:Ano5	UTSW	7	51537813	missense	possibly damaging	0.59
R2248:Ano5	UTSW	7	51593789	missense	probably benign	0.00
R3692:Ano5	UTSW	7	51590579	missense	probably damaging	1.00
R3805:Ano5	UTSW	7	51576650	missense	probably benign	0.22
R3883:Ano5	UTSW	7	51566304	missense	probably damaging	1.00
R3978:Ano5	UTSW	7	51587806	missense	probably benign
R4035:Ano5	UTSW	7	51566485	splice site	probably benign
R4239:Ano5	UTSW	7	51587666	missense	probably damaging	0.99
R4466:Ano5	UTSW	7	51570275	missense	probably damaging	1.00
R4644:Ano5	UTSW	7	51587685	nonsense	probably null
R5021:Ano5	UTSW	7	51556185	missense	probably benign
R5028:Ano5	UTSW	7	51537710	splice site	probably null
R5609:Ano5	UTSW	7	51593637	missense	probably damaging	1.00
R5659:Ano5	UTSW	7	51583814	missense	possibly damaging	0.94
R5660:Ano5	UTSW	7	51583814	missense	possibly damaging	0.94
R5680:Ano5	UTSW	7	51583814	missense	possibly damaging	0.94
R5786:Ano5	UTSW	7	51566318	missense	possibly damaging	0.88
R5787:Ano5	UTSW	7	51566318	missense	possibly damaging	0.88
R5788:Ano5	UTSW	7	51566318	missense	possibly damaging	0.88
R5856:Ano5	UTSW	7	51585326	missense	probably benign	0.01
R5930:Ano5	UTSW	7	51585331	missense	probably damaging	0.99
R5984:Ano5	UTSW	7	51593664	missense	probably damaging	1.00
R6015:Ano5	UTSW	7	51574777	missense	probably benign	0.00
R6030:Ano5	UTSW	7	51574825	missense	probably damaging	1.00
R6030:Ano5	UTSW	7	51574825	missense	probably damaging	1.00
R6247:Ano5	UTSW	7	51566131	splice site	probably null
R7552:Ano5	UTSW	7	51546780	missense	probably benign	0.31
R7559:Ano5	UTSW	7	51574888	missense	probably damaging	1.00
R7712:Ano5	UTSW	7	51573057	missense	probably benign	0.00
R7712:Ano5	UTSW	7	51590655	missense	probably damaging	1.00
R7805:Ano5	UTSW	7	51537800	missense	probably damaging	0.97
R7808:Ano5	UTSW	7	51587795	missense	possibly damaging	0.53
R7840:Ano5	UTSW	7	51587732	missense	possibly damaging	0.88
R7886:Ano5	UTSW	7	51570393	missense	probably benign	0.12
R7975:Ano5	UTSW	7	51566538	missense	probably null	0.98
R8006:Ano5	UTSW	7	51593770	missense	probably benign	0.05
R8060:Ano5	UTSW	7	51587783	missense	probably benign	0.01
R8084:Ano5	UTSW	7	51579539	missense	probably benign	0.01
R8351:Ano5	UTSW	7	51553878	missense	probably benign	0.10
R8504:Ano5	UTSW	7	51573028	missense	probably benign	0.01
X0062:Ano5	UTSW	7	51593651	nonsense	probably null
X0065:Ano5	UTSW	7	51576628	nonsense	probably null
Z1176:Ano5	UTSW	7	51574703	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACAGCTGTGGGATGAACAC -3'
(R):5'- ACAACTTGACAATATCTGAGGCC -3'

Sequencing Primer
(F):5'- TGTGGGATGAACACAGGACC -3'
(R):5'- TGAGGCCACACATCTAACCTGG -3'

Posted On

2015-03-18