Incidental Mutation 'R3723:Ano5'
ID270629
Institutional Source Beutler Lab
Gene Symbol Ano5
Ensembl Gene ENSMUSG00000055489
Gene Nameanoctamin 5
SynonymsGdd1, Tmem16e
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location51511029-51598709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51576528 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 510 (Y510C)
Ref Sequence ENSEMBL: ENSMUSP00000147243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]
Predicted Effect probably damaging
Transcript: ENSMUST00000043944
AA Change: Y543C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489
AA Change: Y543C

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Anoct_dimer 64 280 7.7e-70 PFAM
Pfam:Anoctamin 283 860 6.5e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207044
AA Change: Y510C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207717
Meta Mutation Damage Score 0.3063 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Ano5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Ano5 APN 7 51566513 missense probably damaging 0.96
IGL01328:Ano5 APN 7 51556271 critical splice donor site probably null
IGL01800:Ano5 APN 7 51573075 critical splice donor site probably null
IGL01888:Ano5 APN 7 51566300 missense probably benign 0.06
IGL02221:Ano5 APN 7 51570323 missense probably damaging 1.00
IGL02538:Ano5 APN 7 51583775 missense probably damaging 1.00
IGL03027:Ano5 APN 7 51566277 missense probably damaging 0.99
IGL03133:Ano5 APN 7 51576512 nonsense probably null
IGL03167:Ano5 APN 7 51585511 missense probably damaging 0.98
IGL03233:Ano5 APN 7 51570368 missense probably damaging 1.00
PIT4466001:Ano5 UTSW 7 51544851 missense probably damaging 1.00
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0675:Ano5 UTSW 7 51574810 missense probably damaging 1.00
R0723:Ano5 UTSW 7 51587758 missense probably benign 0.20
R0764:Ano5 UTSW 7 51537842 splice site probably benign
R1159:Ano5 UTSW 7 51579474 splice site probably benign
R1218:Ano5 UTSW 7 51570421 splice site probably null
R1288:Ano5 UTSW 7 51546872 missense probably damaging 1.00
R1329:Ano5 UTSW 7 51546785 missense probably benign
R1484:Ano5 UTSW 7 51566320 missense probably damaging 1.00
R1496:Ano5 UTSW 7 51583775 missense probably damaging 1.00
R1512:Ano5 UTSW 7 51579568 missense probably benign 0.00
R1691:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R1859:Ano5 UTSW 7 51546833 missense probably damaging 1.00
R1991:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2066:Ano5 UTSW 7 51585386 missense probably damaging 1.00
R2088:Ano5 UTSW 7 51587706 missense possibly damaging 0.50
R2103:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2248:Ano5 UTSW 7 51593789 missense probably benign 0.00
R3692:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R3805:Ano5 UTSW 7 51576650 missense probably benign 0.22
R3883:Ano5 UTSW 7 51566304 missense probably damaging 1.00
R3978:Ano5 UTSW 7 51587806 missense probably benign
R4035:Ano5 UTSW 7 51566485 splice site probably benign
R4239:Ano5 UTSW 7 51587666 missense probably damaging 0.99
R4466:Ano5 UTSW 7 51570275 missense probably damaging 1.00
R4644:Ano5 UTSW 7 51587685 nonsense probably null
R5021:Ano5 UTSW 7 51556185 missense probably benign
R5028:Ano5 UTSW 7 51537710 splice site probably null
R5609:Ano5 UTSW 7 51593637 missense probably damaging 1.00
R5659:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5660:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5680:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5786:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5787:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5788:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5856:Ano5 UTSW 7 51585326 missense probably benign 0.01
R5930:Ano5 UTSW 7 51585331 missense probably damaging 0.99
R5984:Ano5 UTSW 7 51593664 missense probably damaging 1.00
R6015:Ano5 UTSW 7 51574777 missense probably benign 0.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6247:Ano5 UTSW 7 51566131 splice site probably null
R7552:Ano5 UTSW 7 51546780 missense probably benign 0.31
R7559:Ano5 UTSW 7 51574888 missense probably damaging 1.00
R7712:Ano5 UTSW 7 51573057 missense probably benign 0.00
R7712:Ano5 UTSW 7 51590655 missense probably damaging 1.00
R7805:Ano5 UTSW 7 51537800 missense probably damaging 0.97
R7808:Ano5 UTSW 7 51587795 missense possibly damaging 0.53
R7840:Ano5 UTSW 7 51587732 missense possibly damaging 0.88
R7886:Ano5 UTSW 7 51570393 missense probably benign 0.12
R7975:Ano5 UTSW 7 51566538 missense probably null 0.98
R8006:Ano5 UTSW 7 51593770 missense probably benign 0.05
R8060:Ano5 UTSW 7 51587783 missense probably benign 0.01
R8084:Ano5 UTSW 7 51579539 missense probably benign 0.01
R8351:Ano5 UTSW 7 51553878 missense probably benign 0.10
R8504:Ano5 UTSW 7 51573028 missense probably benign 0.01
X0062:Ano5 UTSW 7 51593651 nonsense probably null
X0065:Ano5 UTSW 7 51576628 nonsense probably null
Z1176:Ano5 UTSW 7 51574703 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGCTGTGGGATGAACAC -3'
(R):5'- ACAACTTGACAATATCTGAGGCC -3'

Sequencing Primer
(F):5'- TGTGGGATGAACACAGGACC -3'
(R):5'- TGAGGCCACACATCTAACCTGG -3'
Posted On2015-03-18