Incidental Mutation 'R3723:Tnfsf13b'
ID270631
Institutional Source Beutler Lab
Gene Symbol Tnfsf13b
Ensembl Gene ENSMUSG00000031497
Gene Nametumor necrosis factor (ligand) superfamily, member 13b
SynonymsD8Ertd387e, BAFF, BLyS, TALL-1, zTNF4
MMRRC Submission 040714-MU
Accession Numbers

Genbank: NM_033622

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location10006467-10039072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10031545 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 236 (I236V)
Ref Sequence ENSEMBL: ENSMUSP00000146694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033892] [ENSMUST00000207792] [ENSMUST00000208683]
Predicted Effect probably benign
Transcript: ENSMUST00000033892
AA Change: I217V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033892
Gene: ENSMUSG00000031497
AA Change: I217V

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
TNF 169 308 1.88e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207792
AA Change: I236V

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000208683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208770
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice have reduced number of B cells and reduced levels of immunoglobulins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Tnfsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Tnfsf13b APN 8 10031612 missense probably damaging 1.00
IGL01383:Tnfsf13b APN 8 10031528 missense probably damaging 0.98
IGL01650:Tnfsf13b APN 8 10031411 missense probably damaging 1.00
Applecrisp UTSW 8 10031534 missense probably damaging 1.00
arrested UTSW 8 10031545 missense possibly damaging 0.48
Frozen UTSW 8 10031661 splice site probably null
F5493:Tnfsf13b UTSW 8 10006916 missense probably damaging 1.00
R0610:Tnfsf13b UTSW 8 10031661 splice site probably null
R0723:Tnfsf13b UTSW 8 10007166 splice site probably null
R1435:Tnfsf13b UTSW 8 10035358 missense probably benign 0.06
R1648:Tnfsf13b UTSW 8 10031534 missense probably damaging 1.00
R1744:Tnfsf13b UTSW 8 10031661 splice site probably null
R2266:Tnfsf13b UTSW 8 10007306 missense probably benign 0.23
R5230:Tnfsf13b UTSW 8 10031608 missense possibly damaging 0.80
R5913:Tnfsf13b UTSW 8 10006988 missense probably damaging 1.00
R6741:Tnfsf13b UTSW 8 10007314 missense possibly damaging 0.66
R7310:Tnfsf13b UTSW 8 10031651 nonsense probably null
R7882:Tnfsf13b UTSW 8 10007078 missense not run
R8420:Tnfsf13b UTSW 8 10006795 start gained probably benign
Z1177:Tnfsf13b UTSW 8 10035427 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGCTTCTCAGCTTTAAAAGAGG -3'
(R):5'- TCCCAAAGCAGCACTTTTGG -3'

Sequencing Primer
(F):5'- CTCAGCTTTAAAAGAGGAAATGCC -3'
(R):5'- AGGACAGCTACATACCAG -3'
Posted On2015-03-18