Incidental Mutation 'R3723:Ckap4'
ID270635
Institutional Source Beutler Lab
Gene Symbol Ckap4
Ensembl Gene ENSMUSG00000046841
Gene Namecytoskeleton-associated protein 4
SynonymsCLIMP-63, 5630400A09Rik, P63
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84526305-84534062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84528392 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 269 (L269P)
Ref Sequence ENSEMBL: ENSMUSP00000130304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053871] [ENSMUST00000167671]
Predicted Effect probably damaging
Transcript: ENSMUST00000053871
AA Change: L269P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050336
Gene: ENSMUSG00000046841
AA Change: L269P

DomainStartEndE-ValueType
low complexity region 36 59 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
internal_repeat_1 191 233 1.28e-5 PROSPERO
internal_repeat_1 269 311 1.28e-5 PROSPERO
coiled coil region 338 362 N/A INTRINSIC
coiled coil region 408 438 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
coiled coil region 537 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167671
AA Change: L269P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130304
Gene: ENSMUSG00000046841
AA Change: L269P

DomainStartEndE-ValueType
low complexity region 36 59 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
internal_repeat_1 191 233 1.28e-5 PROSPERO
internal_repeat_1 269 311 1.28e-5 PROSPERO
coiled coil region 338 362 N/A INTRINSIC
coiled coil region 408 438 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
coiled coil region 537 575 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Ckap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Ckap4 APN 10 84528590 missense probably damaging 1.00
IGL03251:Ckap4 APN 10 84528605 missense probably damaging 1.00
PIT1430001:Ckap4 UTSW 10 84527766 missense probably damaging 0.99
R0866:Ckap4 UTSW 10 84527520 missense probably damaging 1.00
R1462:Ckap4 UTSW 10 84527567 missense probably damaging 1.00
R1462:Ckap4 UTSW 10 84527567 missense probably damaging 1.00
R1734:Ckap4 UTSW 10 84527874 missense probably benign
R2113:Ckap4 UTSW 10 84533523 missense possibly damaging 0.79
R3958:Ckap4 UTSW 10 84528164 missense probably benign 0.01
R4735:Ckap4 UTSW 10 84533520 missense possibly damaging 0.69
R4746:Ckap4 UTSW 10 84533520 missense possibly damaging 0.69
R4857:Ckap4 UTSW 10 84533488 missense possibly damaging 0.73
R5308:Ckap4 UTSW 10 84528374 missense probably benign 0.01
R5333:Ckap4 UTSW 10 84527610 missense probably damaging 1.00
R5848:Ckap4 UTSW 10 84533490 missense probably benign 0.02
R7383:Ckap4 UTSW 10 84528284 missense probably damaging 1.00
R7402:Ckap4 UTSW 10 84527999 missense probably damaging 0.99
R7453:Ckap4 UTSW 10 84528599 missense probably damaging 1.00
R7757:Ckap4 UTSW 10 84528467 missense probably damaging 1.00
R7966:Ckap4 UTSW 10 84527585 missense probably damaging 1.00
R8098:Ckap4 UTSW 10 84533635 missense probably damaging 0.96
R8337:Ckap4 UTSW 10 84528596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGACGGCACCTTCCTC -3'
(R):5'- TTCACGTCCCTGGAGAACAC -3'

Sequencing Primer
(F):5'- GCAGAAGCTTCTCCGTGAG -3'
(R):5'- TCCCTGGAGAACACAGTCGAG -3'
Posted On2015-03-18