Mutagenetix > Incidental Mutations

Incidental Mutation 'R3723:Mipol1'

270641

Institutional Source

Beutler Lab

Gene Symbol

Mipol1

Ensembl Gene

ENSMUSG00000047022

Gene Name

mirror-image polydactyly 1

Synonyms

1700081O04Rik, 6030439O22Rik, D12Ertd19e

MMRRC Submission

040714-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3723 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57230427-57497199 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 57457092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 349 (L349I)

Ref Sequence

ENSEMBL: ENSMUSP00000117005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000123498
AA Change: L349I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: L349I

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000130447
AA Change: L349I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: L349I

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000145003
AA Change: L349I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: L349I

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000153137
AA Change: L349I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: L349I

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

95% (38/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	T	C	19: 9,016,853	V5167A	possibly damaging	Het
Ano5	A	G	7: 51,576,528	Y510C	probably damaging	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Apob	A	T	12: 8,006,327	Q1570L	probably damaging	Het
Apob	A	G	12: 8,011,763	N3415S	possibly damaging	Het
Arsk	T	A	13: 76,066,653	I361F	probably damaging	Het
C9	G	A	15: 6,483,080	E228K	possibly damaging	Het
Celsr2	A	G	3: 108,397,415		probably benign	Het
Cfap53	A	G	18: 74,359,569	I455V	probably benign	Het
Ckap4	A	G	10: 84,528,392	L269P	probably damaging	Het
Dnah7a	T	A	1: 53,447,346	D3352V	probably benign	Het
Dync2h1	A	T	9: 7,041,658	M3335K	probably benign	Het
Fam171a1	A	G	2: 3,220,375		probably benign	Het
Glis3	A	T	19: 28,262,591	C97*	probably null	Het
Gm13101	T	C	4: 143,966,681	T76A	probably benign	Het
Gm14221	C	G	2: 160,568,427		noncoding transcript	Het
Gm8603	A	C	17: 13,516,813		probably null	Het
Gm9767	G	T	10: 26,078,571		probably benign	Het
Kctd16	A	G	18: 40,258,859	T167A	possibly damaging	Het
Kif18b	A	G	11: 102,916,276	F78L	probably damaging	Het
Mefv	A	G	16: 3,708,194		probably null	Het
Myo10	T	C	15: 25,803,288	V1527A	probably damaging	Het
Naip5	G	T	13: 100,223,014	Y571*	probably null	Het
Npl	A	G	1: 153,515,464	F182L	probably benign	Het
Pan3	T	A	5: 147,503,208		probably benign	Het
Pcdh15	A	T	10: 74,645,848	T342S	probably benign	Het
Pcdhga1	A	G	18: 37,662,992	T350A	possibly damaging	Het
Prdm4	A	G	10: 85,899,281	S666P	probably damaging	Het
Rere	A	G	4: 150,468,795	E148G	probably damaging	Het
Scube2	T	C	7: 109,808,406		probably benign	Het
Sptbn1	A	G	11: 30,137,335	S1035P	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Supt3	A	G	17: 44,994,387	D108G	probably damaging	Het
Tnfsf13b	A	G	8: 10,031,545	I236V	possibly damaging	Het
Tns1	T	C	1: 73,924,940	S1511G	probably damaging	Het
Tpm1	G	A	9: 67,031,945		probably benign	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Vmn1r117	T	A	7: 20,883,455	I223F	probably damaging	Het
Vmn2r91	G	A	17: 18,085,278		probably null	Het
Zfp30	A	G	7: 29,793,353	E344G	probably damaging	Het

Other mutations in Mipol1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Mipol1	APN	12	57307353	splice site	probably benign
IGL01139:Mipol1	APN	12	57306035	nonsense	probably null
IGL02679:Mipol1	APN	12	57306043	missense	possibly damaging	0.84
IGL03109:Mipol1	APN	12	57364224	missense	probably benign	0.20
R0001:Mipol1	UTSW	12	57460839	splice site	probably benign
R0220:Mipol1	UTSW	12	57457150	missense	probably damaging	1.00
R0271:Mipol1	UTSW	12	57460954	unclassified	probably benign
R0284:Mipol1	UTSW	12	57457069	missense	probably damaging	0.98
R0496:Mipol1	UTSW	12	57457177	missense	probably damaging	0.99
R0538:Mipol1	UTSW	12	57414411	critical splice donor site	probably null
R1082:Mipol1	UTSW	12	57325616	missense	probably damaging	0.98
R1552:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R1558:Mipol1	UTSW	12	57332341	missense	probably damaging	1.00
R1928:Mipol1	UTSW	12	57332419	missense	probably damaging	1.00
R2104:Mipol1	UTSW	12	57306056	splice site	probably null
R2495:Mipol1	UTSW	12	57460990	splice site	probably benign
R4431:Mipol1	UTSW	12	57303524	missense	possibly damaging	0.58
R4447:Mipol1	UTSW	12	57352748	intron	probably benign
R4654:Mipol1	UTSW	12	57306132	missense	probably benign	0.22
R4847:Mipol1	UTSW	12	57303496	missense	probably damaging	0.99
R4851:Mipol1	UTSW	12	57332301	missense	probably damaging	1.00
R5113:Mipol1	UTSW	12	57496499	missense	probably benign	0.36
R5668:Mipol1	UTSW	12	57325560	missense	possibly damaging	0.48
R6535:Mipol1	UTSW	12	57306100	missense	possibly damaging	0.95
R7172:Mipol1	UTSW	12	57325535	missense	possibly damaging	0.95
R7191:Mipol1	UTSW	12	57457066	missense	probably benign	0.01
R7560:Mipol1	UTSW	12	57306073	missense	possibly damaging	0.94
R8508:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R8752:Mipol1	UTSW	12	57325581	missense	probably damaging	1.00
R8772:Mipol1	UTSW	12	57325632	missense	probably benign	0.23
R8861:Mipol1	UTSW	12	57306016	missense	probably benign	0.00
R8928:Mipol1	UTSW	12	57460865	missense	probably benign	0.00
R9011:Mipol1	UTSW	12	57457079	missense	probably benign	0.03
R9250:Mipol1	UTSW	12	57414383	missense	probably damaging	1.00
R9383:Mipol1	UTSW	12	57306034	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTAGAAGAGGGGTTTCACATGAAG -3'
(R):5'- AAAACTATGTGGACTGTTGGGTTTC -3'

Sequencing Primer
(F):5'- CAGTTTAACCATGCCCTT -3'
(R):5'- GCTGGATCGGTTACTTAC -3'

Posted On

2015-03-18