Incidental Mutation 'R3723:Arsk'
ID270642
Institutional Source Beutler Lab
Gene Symbol Arsk
Ensembl Gene ENSMUSG00000021592
Gene Namearylsulfatase K
Synonyms
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location76060422-76098660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76066653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 361 (I361F)
Ref Sequence ENSEMBL: ENSMUSP00000113274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120573]
Predicted Effect probably damaging
Transcript: ENSMUST00000120573
AA Change: I361F

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113274
Gene: ENSMUSG00000021592
AA Change: I361F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sulfatase 35 371 6e-49 PFAM
low complexity region 381 392 N/A INTRINSIC
low complexity region 537 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225642
Meta Mutation Damage Score 0.2273 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSK, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Arsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Arsk APN 13 76098368 splice site probably null
IGL02537:Arsk APN 13 76074906 nonsense probably null
IGL02691:Arsk APN 13 76074950 missense probably damaging 0.98
IGL03038:Arsk APN 13 76065513 splice site probably benign
PIT4480001:Arsk UTSW 13 76062365 missense probably damaging 1.00
R0277:Arsk UTSW 13 76074932 missense probably benign 0.01
R0900:Arsk UTSW 13 76098457 unclassified probably benign
R1441:Arsk UTSW 13 76074964 missense probably benign 0.01
R1748:Arsk UTSW 13 76062410 missense probably benign 0.15
R1923:Arsk UTSW 13 76066866 splice site probably benign
R2131:Arsk UTSW 13 76091812 nonsense probably null
R4088:Arsk UTSW 13 76098414 missense probably benign
R4851:Arsk UTSW 13 76065279 critical splice donor site probably null
R5406:Arsk UTSW 13 76093947 missense probably benign
R5629:Arsk UTSW 13 76093908 missense probably damaging 1.00
R5869:Arsk UTSW 13 76091784 missense probably benign 0.29
R6217:Arsk UTSW 13 76091816 missense unknown
R6552:Arsk UTSW 13 76072196 missense probably damaging 0.99
R6560:Arsk UTSW 13 76074986 missense probably benign 0.33
R6726:Arsk UTSW 13 76074788 missense probably damaging 1.00
R7421:Arsk UTSW 13 76062515 missense possibly damaging 0.81
X0050:Arsk UTSW 13 76065280 missense probably null 0.78
X0066:Arsk UTSW 13 76062456 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCCATATACCTTTGAGCCATC -3'
(R):5'- CCACTTGTGTGATGAACTAAAACAC -3'

Sequencing Primer
(F):5'- TGAGCCATCATCCTTGAAGG -3'
(R):5'- TGGCTCTTCACAAGTTAGATCTTC -3'
Posted On2015-03-18