Incidental Mutation 'R3723:Naip5'
ID270643
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 100223014 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 571 (Y571*)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect probably null
Transcript: ENSMUST00000049789
AA Change: Y571*
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: Y571*

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGCTGCTACAAAGAGAGG -3'
(R):5'- TGGCCAACATCATCTGTGCC -3'

Sequencing Primer
(F):5'- AGAGGGGTCTTGTAAACTCCC -3'
(R):5'- ATCTGTGCCCAACTCCTAGGG -3'
Posted On2015-03-18