Incidental Mutation 'R3723:Mefv'
ID270646
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene NameMediterranean fever
SynonymsTRIM20, marenostrin, pyrin, FMF
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3707218-3718097 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 3708194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
Predicted Effect probably null
Transcript: ENSMUST00000023180
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100222
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229725
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3710960 missense probably benign 0.01
IGL00583:Mefv APN 16 3716072 nonsense probably null
IGL00963:Mefv APN 16 3715720 missense possibly damaging 0.83
IGL02185:Mefv APN 16 3715850 missense probably benign 0.09
IGL02500:Mefv APN 16 3713577 missense probably damaging 1.00
R0158:Mefv UTSW 16 3715456 missense possibly damaging 0.67
R1312:Mefv UTSW 16 3708534 splice site probably benign
R1793:Mefv UTSW 16 3708664 missense possibly damaging 0.53
R1956:Mefv UTSW 16 3717827 missense probably damaging 1.00
R2169:Mefv UTSW 16 3710888 missense probably benign 0.24
R2973:Mefv UTSW 16 3715694 nonsense probably null
R3724:Mefv UTSW 16 3708194 critical splice donor site probably null
R3953:Mefv UTSW 16 3715400 missense possibly damaging 0.60
R4276:Mefv UTSW 16 3715569 missense probably benign 0.41
R4650:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4651:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4652:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4670:Mefv UTSW 16 3708207 missense possibly damaging 0.67
R4781:Mefv UTSW 16 3715334 missense probably benign 0.00
R5593:Mefv UTSW 16 3715451 missense probably benign 0.00
R5834:Mefv UTSW 16 3716046 missense probably damaging 0.97
R5867:Mefv UTSW 16 3715933 missense probably damaging 1.00
R5954:Mefv UTSW 16 3715715 missense probably benign 0.09
R6056:Mefv UTSW 16 3708042 missense possibly damaging 0.73
R6260:Mefv UTSW 16 3713034 missense probably benign 0.03
R6409:Mefv UTSW 16 3710793 critical splice donor site probably null
R6511:Mefv UTSW 16 3715946 missense probably benign 0.00
R6666:Mefv UTSW 16 3707998 missense possibly damaging 0.88
R6952:Mefv UTSW 16 3710880 missense probably damaging 1.00
R7259:Mefv UTSW 16 3713053 missense probably damaging 1.00
R7410:Mefv UTSW 16 3715681 missense probably damaging 1.00
R7444:Mefv UTSW 16 3715522 missense probably benign 0.21
X0064:Mefv UTSW 16 3710841 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATCACGGTAACTGCAGGAAG -3'
(R):5'- TAAAAGGCCCCAGAGTTCTGC -3'

Sequencing Primer
(F):5'- CTGCAGGAAGAAGAATGCCTAGC -3'
(R):5'- CCAGAGTTCTGCCTTGTTGATTGAAG -3'
Posted On2015-03-18