Mutagenetix > Incidental Mutations

Incidental Mutation 'R3723:Mefv'

270646

Institutional Source

Beutler Lab

Gene Symbol

Mefv

Ensembl Gene

ENSMUSG00000022534

Gene Name

Mediterranean fever

Synonyms

TRIM20, marenostrin, pyrin, FMF

MMRRC Submission

040714-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R3723 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3707218-3718097 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 3708194 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]

Predicted Effect

probably null
Transcript: ENSMUST00000023180

SMART Domains

Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534

Domain	Start	End	E-Value	Type
PYRIN	5	88	8.89e-32	SMART
BBOX	439	481	4.75e-11	SMART
low complexity region	490	503	N/A	INTRINSIC
SCOP:d1f5qb1	519	616	8e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100222

SMART Domains

Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534

Domain	Start	End	E-Value	Type
PYRIN	5	88	8.89e-32	SMART
BBOX	469	511	4.75e-11	SMART
low complexity region	520	533	N/A	INTRINSIC
SCOP:d1f5qb1	549	646	6e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229725

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

95% (38/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	T	C	19: 9,016,853	V5167A	possibly damaging	Het
Ano5	A	G	7: 51,576,528	Y510C	probably damaging	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Apob	A	T	12: 8,006,327	Q1570L	probably damaging	Het
Apob	A	G	12: 8,011,763	N3415S	possibly damaging	Het
Arsk	T	A	13: 76,066,653	I361F	probably damaging	Het
C9	G	A	15: 6,483,080	E228K	possibly damaging	Het
Celsr2	A	G	3: 108,397,415		probably benign	Het
Cfap53	A	G	18: 74,359,569	I455V	probably benign	Het
Ckap4	A	G	10: 84,528,392	L269P	probably damaging	Het
Dnah7a	T	A	1: 53,447,346	D3352V	probably benign	Het
Dync2h1	A	T	9: 7,041,658	M3335K	probably benign	Het
Fam171a1	A	G	2: 3,220,375		probably benign	Het
Glis3	A	T	19: 28,262,591	C97*	probably null	Het
Gm13101	T	C	4: 143,966,681	T76A	probably benign	Het
Gm14221	C	G	2: 160,568,427		noncoding transcript	Het
Gm8603	A	C	17: 13,516,813		probably null	Het
Gm9767	G	T	10: 26,078,571		probably benign	Het
Kctd16	A	G	18: 40,258,859	T167A	possibly damaging	Het
Kif18b	A	G	11: 102,916,276	F78L	probably damaging	Het
Mipol1	C	A	12: 57,457,092	L349I	probably damaging	Het
Myo10	T	C	15: 25,803,288	V1527A	probably damaging	Het
Naip5	G	T	13: 100,223,014	Y571*	probably null	Het
Npl	A	G	1: 153,515,464	F182L	probably benign	Het
Pan3	T	A	5: 147,503,208		probably benign	Het
Pcdh15	A	T	10: 74,645,848	T342S	probably benign	Het
Pcdhga1	A	G	18: 37,662,992	T350A	possibly damaging	Het
Prdm4	A	G	10: 85,899,281	S666P	probably damaging	Het
Rere	A	G	4: 150,468,795	E148G	probably damaging	Het
Scube2	T	C	7: 109,808,406		probably benign	Het
Sptbn1	A	G	11: 30,137,335	S1035P	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Supt3	A	G	17: 44,994,387	D108G	probably damaging	Het
Tnfsf13b	A	G	8: 10,031,545	I236V	possibly damaging	Het
Tns1	T	C	1: 73,924,940	S1511G	probably damaging	Het
Tpm1	G	A	9: 67,031,945		probably benign	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Vmn1r117	T	A	7: 20,883,455	I223F	probably damaging	Het
Vmn2r91	G	A	17: 18,085,278		probably null	Het
Zfp30	A	G	7: 29,793,353	E344G	probably damaging	Het

Other mutations in Mefv

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Mefv	APN	16	3710960	missense	probably benign	0.01
IGL00583:Mefv	APN	16	3716072	nonsense	probably null
IGL00963:Mefv	APN	16	3715720	missense	possibly damaging	0.83
IGL02185:Mefv	APN	16	3715850	missense	probably benign	0.09
IGL02500:Mefv	APN	16	3713577	missense	probably damaging	1.00
R0158:Mefv	UTSW	16	3715456	missense	possibly damaging	0.67
R1312:Mefv	UTSW	16	3708534	splice site	probably benign
R1793:Mefv	UTSW	16	3708664	missense	possibly damaging	0.53
R1956:Mefv	UTSW	16	3717827	missense	probably damaging	1.00
R2169:Mefv	UTSW	16	3710888	missense	probably benign	0.24
R2973:Mefv	UTSW	16	3715694	nonsense	probably null
R3724:Mefv	UTSW	16	3708194	critical splice donor site	probably null
R3953:Mefv	UTSW	16	3715400	missense	possibly damaging	0.60
R4276:Mefv	UTSW	16	3715569	missense	probably benign	0.41
R4650:Mefv	UTSW	16	3717818	missense	probably damaging	1.00
R4651:Mefv	UTSW	16	3717818	missense	probably damaging	1.00
R4652:Mefv	UTSW	16	3717818	missense	probably damaging	1.00
R4670:Mefv	UTSW	16	3708207	missense	possibly damaging	0.67
R4781:Mefv	UTSW	16	3715334	missense	probably benign	0.00
R5593:Mefv	UTSW	16	3715451	missense	probably benign	0.00
R5834:Mefv	UTSW	16	3716046	missense	probably damaging	0.97
R5867:Mefv	UTSW	16	3715933	missense	probably damaging	1.00
R5954:Mefv	UTSW	16	3715715	missense	probably benign	0.09
R6056:Mefv	UTSW	16	3708042	missense	possibly damaging	0.73
R6260:Mefv	UTSW	16	3713034	missense	probably benign	0.03
R6409:Mefv	UTSW	16	3710793	critical splice donor site	probably null
R6511:Mefv	UTSW	16	3715946	missense	probably benign	0.00
R6666:Mefv	UTSW	16	3707998	missense	possibly damaging	0.88
R6952:Mefv	UTSW	16	3710880	missense	probably damaging	1.00
R7259:Mefv	UTSW	16	3713053	missense	probably damaging	1.00
R7410:Mefv	UTSW	16	3715681	missense	probably damaging	1.00
R7444:Mefv	UTSW	16	3715522	missense	probably benign	0.21
R8140:Mefv	UTSW	16	3713635	missense	probably benign	0.00
R8183:Mefv	UTSW	16	3708582	missense	possibly damaging	0.70
R8279:Mefv	UTSW	16	3715222	missense	unknown
X0064:Mefv	UTSW	16	3710841	missense	possibly damaging	0.71
Z1176:Mefv	UTSW	16	3715455	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- ATCACGGTAACTGCAGGAAG -3'
(R):5'- TAAAAGGCCCCAGAGTTCTGC -3'

Sequencing Primer
(F):5'- CTGCAGGAAGAAGAATGCCTAGC -3'
(R):5'- CCAGAGTTCTGCCTTGTTGATTGAAG -3'

Posted On

2015-03-18