Incidental Mutation 'R3723:Supt3'
ID270648
Institutional Source Beutler Lab
Gene Symbol Supt3
Ensembl Gene ENSMUSG00000038954
Gene Namesuppressor of Ty 3
SynonymsSPT3, 2310066G22Rik, SPT3L, Supt3h
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location44777152-45119290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44994387 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 108 (D108G)
Ref Sequence ENSEMBL: ENSMUSP00000120197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050630] [ENSMUST00000127798] [ENSMUST00000129416]
Predicted Effect probably benign
Transcript: ENSMUST00000050630
AA Change: D115G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050783
Gene: ENSMUSG00000038954
AA Change: D115G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 4.5e-38 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127798
AA Change: D115G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121148
Gene: ENSMUSG00000038954
AA Change: D115G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:TFIID-18kDa 24 116 9.3e-39 PFAM
low complexity region 274 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129416
AA Change: D108G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120197
Gene: ENSMUSG00000038954
AA Change: D108G

DomainStartEndE-ValueType
Pfam:TFIID-18kDa 17 109 1e-38 PFAM
low complexity region 267 287 N/A INTRINSIC
Meta Mutation Damage Score 0.1061 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Supt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Supt3 APN 17 45119158 missense possibly damaging 0.72
IGL02171:Supt3 APN 17 45003156 missense probably damaging 1.00
IGL02954:Supt3 APN 17 45038128 missense probably damaging 0.99
IGL03115:Supt3 APN 17 45041227 missense probably damaging 1.00
IGL03166:Supt3 APN 17 44923219 missense probably damaging 1.00
pottery UTSW 17 45041229 nonsense probably null
R0122:Supt3 UTSW 17 45003141 missense probably damaging 1.00
R0245:Supt3 UTSW 17 45036775 missense probably benign 0.12
R0517:Supt3 UTSW 17 45119271 missense probably benign 0.18
R0539:Supt3 UTSW 17 45003131 missense possibly damaging 0.95
R1485:Supt3 UTSW 17 45036720 missense probably benign 0.21
R4540:Supt3 UTSW 17 45036775 missense probably benign 0.12
R4570:Supt3 UTSW 17 45041229 nonsense probably null
R6429:Supt3 UTSW 17 45119143 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTTCTGCAGGGCCACATTTTC -3'
(R):5'- GAGCTCTATAATGTCCCAGAGGAG -3'

Sequencing Primer
(F):5'- GCAGGGCCACATTTTCCACTTATAC -3'
(R):5'- TCTATAATGTCCCAGAGGAGAAAAAG -3'
Posted On2015-03-18