Mutagenetix > Incidental Mutations

Incidental Mutation 'R3723:Cfap53'

270650

Institutional Source

Beutler Lab

Gene Symbol

Cfap53

Ensembl Gene

ENSMUSG00000035394

Gene Name

cilia and flagella associated protein 53

Synonyms

4933415I03Rik, Ccdc11

MMRRC Submission

040714-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R3723 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74283090-74359986 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74359569 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 455 (I455V)

Ref Sequence

ENSEMBL: ENSMUSP00000110545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]

Predicted Effect

probably benign
Transcript: ENSMUST00000114895
AA Change: I455V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394
AA Change: I455V

Domain	Start	End	E-Value	Type
low complexity region	131	145	N/A	INTRINSIC
Pfam:TPH	160	495	1.3e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176435

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177407

Meta Mutation Damage Score

0.0702

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

95% (38/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	T	C	19: 9,016,853	V5167A	possibly damaging	Het
Ano5	A	G	7: 51,576,528	Y510C	probably damaging	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Apob	A	T	12: 8,006,327	Q1570L	probably damaging	Het
Apob	A	G	12: 8,011,763	N3415S	possibly damaging	Het
Arsk	T	A	13: 76,066,653	I361F	probably damaging	Het
C9	G	A	15: 6,483,080	E228K	possibly damaging	Het
Celsr2	A	G	3: 108,397,415		probably benign	Het
Ckap4	A	G	10: 84,528,392	L269P	probably damaging	Het
Dnah7a	T	A	1: 53,447,346	D3352V	probably benign	Het
Dync2h1	A	T	9: 7,041,658	M3335K	probably benign	Het
Fam171a1	A	G	2: 3,220,375		probably benign	Het
Glis3	A	T	19: 28,262,591	C97*	probably null	Het
Gm13101	T	C	4: 143,966,681	T76A	probably benign	Het
Gm14221	C	G	2: 160,568,427		noncoding transcript	Het
Gm8603	A	C	17: 13,516,813		probably null	Het
Gm9767	G	T	10: 26,078,571		probably benign	Het
Kctd16	A	G	18: 40,258,859	T167A	possibly damaging	Het
Kif18b	A	G	11: 102,916,276	F78L	probably damaging	Het
Mefv	A	G	16: 3,708,194		probably null	Het
Mipol1	C	A	12: 57,457,092	L349I	probably damaging	Het
Myo10	T	C	15: 25,803,288	V1527A	probably damaging	Het
Naip5	G	T	13: 100,223,014	Y571*	probably null	Het
Npl	A	G	1: 153,515,464	F182L	probably benign	Het
Pan3	T	A	5: 147,503,208		probably benign	Het
Pcdh15	A	T	10: 74,645,848	T342S	probably benign	Het
Pcdhga1	A	G	18: 37,662,992	T350A	possibly damaging	Het
Prdm4	A	G	10: 85,899,281	S666P	probably damaging	Het
Rere	A	G	4: 150,468,795	E148G	probably damaging	Het
Scube2	T	C	7: 109,808,406		probably benign	Het
Sptbn1	A	G	11: 30,137,335	S1035P	possibly damaging	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Supt3	A	G	17: 44,994,387	D108G	probably damaging	Het
Tnfsf13b	A	G	8: 10,031,545	I236V	possibly damaging	Het
Tns1	T	C	1: 73,924,940	S1511G	probably damaging	Het
Tpm1	G	A	9: 67,031,945		probably benign	Het
Uba6	T	C	5: 86,135,047	D559G	probably damaging	Het
Vmn1r117	T	A	7: 20,883,455	I223F	probably damaging	Het
Vmn2r91	G	A	17: 18,085,278		probably null	Het
Zfp30	A	G	7: 29,793,353	E344G	probably damaging	Het

Other mutations in Cfap53

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00579:Cfap53	APN	18	74305540	nonsense	probably null
IGL00667:Cfap53	APN	18	74300192	missense	probably damaging	1.00
IGL00917:Cfap53	APN	18	74299296	missense	probably benign	0.08
R0009:Cfap53	UTSW	18	74299176	missense	probably benign	0.00
R0009:Cfap53	UTSW	18	74299176	missense	probably benign	0.00
R0035:Cfap53	UTSW	18	74300207	missense	probably damaging	1.00
R0035:Cfap53	UTSW	18	74300207	missense	probably damaging	1.00
R0048:Cfap53	UTSW	18	74299173	missense	probably benign	0.09
R0601:Cfap53	UTSW	18	74300150	missense	possibly damaging	0.94
R0939:Cfap53	UTSW	18	74305730	missense	probably null	0.72
R1166:Cfap53	UTSW	18	74300180	missense	possibly damaging	0.68
R1588:Cfap53	UTSW	18	74307373	missense	probably benign
R2105:Cfap53	UTSW	18	74283223	missense	possibly damaging	0.73
R2186:Cfap53	UTSW	18	74329505	splice site	probably null
R3724:Cfap53	UTSW	18	74359569	missense	probably benign	0.13
R3904:Cfap53	UTSW	18	74307374	missense	probably damaging	0.99
R5156:Cfap53	UTSW	18	74359767	utr 3 prime	probably benign
R5262:Cfap53	UTSW	18	74329459	missense	probably benign	0.39
R5928:Cfap53	UTSW	18	74359740	missense	possibly damaging	0.90
R6405:Cfap53	UTSW	18	74359606	missense	probably damaging	1.00
R6653:Cfap53	UTSW	18	74300209	missense	probably damaging	0.97
R6675:Cfap53	UTSW	18	74307376	critical splice donor site	probably null
R7011:Cfap53	UTSW	18	74329493	missense	probably benign	0.13
R7397:Cfap53	UTSW	18	74283223	missense	possibly damaging	0.73
Z1177:Cfap53	UTSW	18	74305552	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCAGTTCTTGGTCTCAAAGTG -3'
(R):5'- ACTCGGAGAATAAGCGTTTATCC -3'

Sequencing Primer
(F):5'- CTAGACCACATTAATGGAAACA -3'
(R):5'- GCGTTTATCCATTAGTCAAAAGGTG -3'

Posted On

2015-03-18