Incidental Mutation 'R3723:Cfap53'
ID270650
Institutional Source Beutler Lab
Gene Symbol Cfap53
Ensembl Gene ENSMUSG00000035394
Gene Namecilia and flagella associated protein 53
Synonyms4933415I03Rik, Ccdc11
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74283090-74359986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74359569 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 455 (I455V)
Ref Sequence ENSEMBL: ENSMUSP00000110545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114895] [ENSMUST00000176435]
Predicted Effect probably benign
Transcript: ENSMUST00000114895
AA Change: I455V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110545
Gene: ENSMUSG00000035394
AA Change: I455V

DomainStartEndE-ValueType
low complexity region 131 145 N/A INTRINSIC
Pfam:TPH 160 495 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177407
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. Mutations in this gene are associated with visceral heterotaxy-6, which implicates this gene in determination of left-right asymmetric patterning. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Glis3 A T 19: 28,262,591 C97* probably null Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Cfap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cfap53 APN 18 74305540 nonsense probably null
IGL00667:Cfap53 APN 18 74300192 missense probably damaging 1.00
IGL00917:Cfap53 APN 18 74299296 missense probably benign 0.08
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0009:Cfap53 UTSW 18 74299176 missense probably benign 0.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0035:Cfap53 UTSW 18 74300207 missense probably damaging 1.00
R0048:Cfap53 UTSW 18 74299173 missense probably benign 0.09
R0601:Cfap53 UTSW 18 74300150 missense possibly damaging 0.94
R0939:Cfap53 UTSW 18 74305730 missense probably null 0.72
R1166:Cfap53 UTSW 18 74300180 missense possibly damaging 0.68
R1588:Cfap53 UTSW 18 74307373 missense probably benign
R2105:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
R2186:Cfap53 UTSW 18 74329505 splice site probably null
R3724:Cfap53 UTSW 18 74359569 missense probably benign 0.13
R3904:Cfap53 UTSW 18 74307374 missense probably damaging 0.99
R5156:Cfap53 UTSW 18 74359767 utr 3 prime probably benign
R5262:Cfap53 UTSW 18 74329459 missense probably benign 0.39
R5928:Cfap53 UTSW 18 74359740 missense possibly damaging 0.90
R6405:Cfap53 UTSW 18 74359606 missense probably damaging 1.00
R6653:Cfap53 UTSW 18 74300209 missense probably damaging 0.97
R6675:Cfap53 UTSW 18 74307376 critical splice donor site probably null
R7011:Cfap53 UTSW 18 74329493 missense probably benign 0.13
R7397:Cfap53 UTSW 18 74283223 missense possibly damaging 0.73
Z1177:Cfap53 UTSW 18 74305552 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCAGTTCTTGGTCTCAAAGTG -3'
(R):5'- ACTCGGAGAATAAGCGTTTATCC -3'

Sequencing Primer
(F):5'- CTAGACCACATTAATGGAAACA -3'
(R):5'- GCGTTTATCCATTAGTCAAAAGGTG -3'
Posted On2015-03-18