Incidental Mutation 'R3723:Glis3'
ID270652
Institutional Source Beutler Lab
Gene Symbol Glis3
Ensembl Gene ENSMUSG00000052942
Gene NameGLIS family zinc finger 3
SynonymsE330013K21Rik, 4833409N03Rik
MMRRC Submission 040714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R3723 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28258851-28680077 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28262591 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 97 (C97*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065113] [ENSMUST00000162022]
Predicted Effect probably benign
Transcript: ENSMUST00000065113
SMART Domains Protein: ENSMUSP00000066953
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161026
Predicted Effect probably benign
Transcript: ENSMUST00000162022
SMART Domains Protein: ENSMUSP00000124635
Gene: ENSMUSG00000052942

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
low complexity region 203 222 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
ZnF_C2H2 500 525 1.07e0 SMART
ZnF_C2H2 534 561 6.13e-1 SMART
ZnF_C2H2 567 591 3.89e-3 SMART
ZnF_C2H2 597 621 1.45e-2 SMART
ZnF_C2H2 627 651 9.08e-4 SMART
low complexity region 700 709 N/A INTRINSIC
low complexity region 722 746 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162873
Predicted Effect probably null
Transcript: ENSMUST00000172141
AA Change: C97*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein which contains multiple C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the transcriptional regulation of insulin. It is thought to enhance GLI-RE-dependent transcription by binding to the GLI-RE consensus sequence (GACCACCCAC). Mutations in a similar gene in human have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit postnatal lethality associated with neonatal diabetes and polycystic kidney disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,016,853 V5167A possibly damaging Het
Ano5 A G 7: 51,576,528 Y510C probably damaging Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Apob A T 12: 8,006,327 Q1570L probably damaging Het
Apob A G 12: 8,011,763 N3415S possibly damaging Het
Arsk T A 13: 76,066,653 I361F probably damaging Het
C9 G A 15: 6,483,080 E228K possibly damaging Het
Celsr2 A G 3: 108,397,415 probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ckap4 A G 10: 84,528,392 L269P probably damaging Het
Dnah7a T A 1: 53,447,346 D3352V probably benign Het
Dync2h1 A T 9: 7,041,658 M3335K probably benign Het
Fam171a1 A G 2: 3,220,375 probably benign Het
Gm13101 T C 4: 143,966,681 T76A probably benign Het
Gm14221 C G 2: 160,568,427 noncoding transcript Het
Gm8603 A C 17: 13,516,813 probably null Het
Gm9767 G T 10: 26,078,571 probably benign Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Kif18b A G 11: 102,916,276 F78L probably damaging Het
Mefv A G 16: 3,708,194 probably null Het
Mipol1 C A 12: 57,457,092 L349I probably damaging Het
Myo10 T C 15: 25,803,288 V1527A probably damaging Het
Naip5 G T 13: 100,223,014 Y571* probably null Het
Npl A G 1: 153,515,464 F182L probably benign Het
Pan3 T A 5: 147,503,208 probably benign Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Pcdhga1 A G 18: 37,662,992 T350A possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rere A G 4: 150,468,795 E148G probably damaging Het
Scube2 T C 7: 109,808,406 probably benign Het
Sptbn1 A G 11: 30,137,335 S1035P possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Supt3 A G 17: 44,994,387 D108G probably damaging Het
Tnfsf13b A G 8: 10,031,545 I236V possibly damaging Het
Tns1 T C 1: 73,924,940 S1511G probably damaging Het
Tpm1 G A 9: 67,031,945 probably benign Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn1r117 T A 7: 20,883,455 I223F probably damaging Het
Vmn2r91 G A 17: 18,085,278 probably null Het
Zfp30 A G 7: 29,793,353 E344G probably damaging Het
Other mutations in Glis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Glis3 APN 19 28540264 missense probably damaging 1.00
IGL02240:Glis3 APN 19 28531525 missense probably damaging 1.00
IGL02347:Glis3 APN 19 28531883 missense probably benign
IGL02904:Glis3 APN 19 28357952 missense possibly damaging 0.58
glee UTSW 19 28262677 utr 3 prime probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0071:Glis3 UTSW 19 28263855 splice site probably benign
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0106:Glis3 UTSW 19 28531868 missense possibly damaging 0.67
R0399:Glis3 UTSW 19 28298768 splice site probably benign
R1462:Glis3 UTSW 19 28262518 utr 3 prime probably benign
R1901:Glis3 UTSW 19 28531585 missense probably damaging 1.00
R1976:Glis3 UTSW 19 28262677 utr 3 prime probably benign
R1982:Glis3 UTSW 19 28531274 missense probably damaging 1.00
R2155:Glis3 UTSW 19 28531302 missense probably benign 0.16
R4496:Glis3 UTSW 19 28666127 missense possibly damaging 0.90
R4921:Glis3 UTSW 19 28666104 missense probably damaging 1.00
R5088:Glis3 UTSW 19 28531579 missense probably benign 0.00
R5241:Glis3 UTSW 19 28350023 missense probably benign 0.02
R5557:Glis3 UTSW 19 28264009 missense probably benign 0.00
R6226:Glis3 UTSW 19 28317302 missense probably damaging 1.00
R6309:Glis3 UTSW 19 28317361 missense probably benign 0.24
R6488:Glis3 UTSW 19 28298853 missense probably benign 0.13
R7069:Glis3 UTSW 19 28531519 missense probably damaging 1.00
R7260:Glis3 UTSW 19 28531402 missense probably benign
R7313:Glis3 UTSW 19 28531019 missense probably damaging 1.00
R7320:Glis3 UTSW 19 28531598 missense probably damaging 1.00
R7767:Glis3 UTSW 19 28263960 missense probably benign 0.18
R7839:Glis3 UTSW 19 28317373 missense possibly damaging 0.81
R8133:Glis3 UTSW 19 28350006 missense probably benign 0.00
T0970:Glis3 UTSW 19 28530932 missense probably damaging 1.00
Z1176:Glis3 UTSW 19 28283768 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAATACACGTACCCGGGATTG -3'
(R):5'- GCAGGAGTTTCTTTTCAAAGGG -3'

Sequencing Primer
(F):5'- CACGTACCCGGGATTGATTAAAAATG -3'
(R):5'- GGGAATTTAGAGTCTCACTTTAAGG -3'
Posted On2015-03-18