Incidental Mutation 'R3724:Api5'
ID270664
Institutional Source Beutler Lab
Gene Symbol Api5
Ensembl Gene ENSMUSG00000027193
Gene Nameapoptosis inhibitor 5
SynonymsAAC-11
MMRRC Submission 040715-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R3724 (G1)
Quality Score222
Status Not validated
Chromosome2
Chromosomal Location94411682-94438136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94425613 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 243 (R243Q)
Ref Sequence ENSEMBL: ENSMUSP00000028617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028617
AA Change: R243Q

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028617
Gene: ENSMUSG00000027193
AA Change: R243Q

DomainStartEndE-ValueType
Pfam:API5 4 504 8.9e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152454
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an apoptosis inhibitory protein whose expression prevents apoptosis after growth factor deprivation. This protein suppresses the transcription factor E2F1-induced apoptosis and also interacts with, and negatively regulates Acinus, a nuclear factor involved in apoptotic DNA fragmentation. Its depletion enhances the cytotoxic action of the chemotherapeutic drugs. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,149,360 R133L probably damaging Het
Abhd8 G A 8: 71,461,492 A164V probably benign Het
Atl1 A G 12: 69,959,380 T487A probably damaging Het
C2cd6 C T 1: 59,066,235 probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Ccna1 T C 3: 55,050,932 E110G probably damaging Het
Ccne2 T C 4: 11,203,039 C386R probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ctdp1 C T 18: 80,459,267 V143I probably benign Het
Cyp11a1 A T 9: 58,019,322 M47L probably benign Het
Dnah5 T C 15: 28,270,420 L956P probably benign Het
Enkd1 A T 8: 105,703,925 V326E possibly damaging Het
Epha4 A G 1: 77,426,543 probably benign Het
Etv5 T C 16: 22,435,912 D66G probably damaging Het
Evi5l A G 8: 4,178,080 probably benign Het
Foxf2 A G 13: 31,630,530 K409R probably damaging Het
Frem3 A G 8: 80,615,271 T1398A probably benign Het
Galm A G 17: 80,183,280 T289A probably benign Het
Gtdc1 T C 2: 44,756,307 E44G probably damaging Het
Hmcn1 T A 1: 150,689,518 Y2286F possibly damaging Het
Iars A G 13: 49,687,384 probably null Het
Ifna5 A G 4: 88,835,934 E137G probably damaging Het
Itih4 G A 14: 30,892,584 E468K possibly damaging Het
Kat6a A T 8: 22,862,788 H196L probably damaging Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Klhl29 C T 12: 5,090,603 V680I probably damaging Het
March7 T C 2: 60,229,745 I72T probably benign Het
Mbd6 C T 10: 127,283,891 probably benign Het
Mefv A G 16: 3,708,194 probably null Het
Mindy3 T A 2: 12,355,354 M6L probably damaging Het
Mrpl9 T A 3: 94,447,766 probably null Het
Nlrp4e A T 7: 23,321,377 T430S probably benign Het
Olfr1187-ps1 T G 2: 88,540,286 noncoding transcript Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Prkce A T 17: 86,168,623 K11* probably null Het
Pros1 T C 16: 62,900,329 I117T possibly damaging Het
Prpf38b T C 3: 108,904,340 probably benign Het
Sh3rf1 T C 8: 61,372,722 S584P probably benign Het
Slit2 T C 5: 48,256,883 probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Stambp C T 6: 83,557,466 E280K probably damaging Het
Tenm3 A G 8: 48,277,746 I1329T probably damaging Het
Tex2 G A 11: 106,529,330 T869I unknown Het
Tlk2 A G 11: 105,247,564 T281A probably benign Het
Tpm1 G A 9: 67,031,945 probably benign Het
Trim3 A G 7: 105,611,189 F702L probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn2r20 T A 6: 123,385,747 T693S probably benign Het
Zfand2b A G 1: 75,169,855 K125E possibly damaging Het
Zfp422 C T 6: 116,626,379 A220T probably benign Het
Zfp747 A T 7: 127,374,590 V136D probably benign Het
Other mutations in Api5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Api5 APN 2 94418954 splice site probably benign
IGL02203:Api5 APN 2 94425074 missense probably benign 0.00
IGL02346:Api5 APN 2 94427530 missense possibly damaging 0.77
IGL02605:Api5 APN 2 94429719 missense possibly damaging 0.88
IGL02646:Api5 APN 2 94429839 missense possibly damaging 0.62
R0018:Api5 UTSW 2 94420984 critical splice donor site probably null
R0149:Api5 UTSW 2 94423497 nonsense probably null
R0361:Api5 UTSW 2 94423497 nonsense probably null
R1554:Api5 UTSW 2 94425643 missense probably benign 0.14
R2507:Api5 UTSW 2 94429817 missense probably damaging 1.00
R3723:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3737:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3738:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4035:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4724:Api5 UTSW 2 94423471 missense possibly damaging 0.95
R5306:Api5 UTSW 2 94423466 nonsense probably null
R5337:Api5 UTSW 2 94425688 missense possibly damaging 0.94
R6577:Api5 UTSW 2 94422381 missense probably benign 0.24
R7031:Api5 UTSW 2 94425616 missense probably benign 0.01
R7936:Api5 UTSW 2 94438047 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAAATGTCTTGCTGCCTTGG -3'
(R):5'- AAATGCTGTTCTTCTCGATTGCG -3'

Sequencing Primer
(F):5'- TGGGTTCTTCCAGTGCCGC -3'
(R):5'- TTCTAGGTCCTAGAAGACGTGAC -3'
Posted On2015-03-18