Incidental Mutation 'R3724:Zfp422'
ID270672
Institutional Source Beutler Lab
Gene Symbol Zfp422
Ensembl Gene ENSMUSG00000059878
Gene Namezinc finger protein 422
SynonymsKrox26, 2900028O21Rik, Krox-26, Krox25, KOX15, Krox-25-2
MMRRC Submission 040715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3724 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116624016-116628999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116626379 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 220 (A220T)
Ref Sequence ENSEMBL: ENSMUSP00000108501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057540] [ENSMUST00000079749] [ENSMUST00000112880]
Predicted Effect probably benign
Transcript: ENSMUST00000057540
AA Change: A220T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084926
Gene: ENSMUSG00000059878
AA Change: A220T

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079749
AA Change: A220T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078685
Gene: ENSMUSG00000059878
AA Change: A220T

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112880
AA Change: A220T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108501
Gene: ENSMUSG00000059878
AA Change: A220T

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204559
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a putative C2H2 zinc finger transcription factor that may play a role in tooth development. A pseudogene related to this gene is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,149,360 R133L probably damaging Het
Abhd8 G A 8: 71,461,492 A164V probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atl1 A G 12: 69,959,380 T487A probably damaging Het
C2cd6 C T 1: 59,066,235 probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Ccna1 T C 3: 55,050,932 E110G probably damaging Het
Ccne2 T C 4: 11,203,039 C386R probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ctdp1 C T 18: 80,459,267 V143I probably benign Het
Cyp11a1 A T 9: 58,019,322 M47L probably benign Het
Dnah5 T C 15: 28,270,420 L956P probably benign Het
Enkd1 A T 8: 105,703,925 V326E possibly damaging Het
Epha4 A G 1: 77,426,543 probably benign Het
Etv5 T C 16: 22,435,912 D66G probably damaging Het
Evi5l A G 8: 4,178,080 probably benign Het
Foxf2 A G 13: 31,630,530 K409R probably damaging Het
Frem3 A G 8: 80,615,271 T1398A probably benign Het
Galm A G 17: 80,183,280 T289A probably benign Het
Gtdc1 T C 2: 44,756,307 E44G probably damaging Het
Hmcn1 T A 1: 150,689,518 Y2286F possibly damaging Het
Iars A G 13: 49,687,384 probably null Het
Ifna5 A G 4: 88,835,934 E137G probably damaging Het
Itih4 G A 14: 30,892,584 E468K possibly damaging Het
Kat6a A T 8: 22,862,788 H196L probably damaging Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Klhl29 C T 12: 5,090,603 V680I probably damaging Het
March7 T C 2: 60,229,745 I72T probably benign Het
Mbd6 C T 10: 127,283,891 probably benign Het
Mefv A G 16: 3,708,194 probably null Het
Mindy3 T A 2: 12,355,354 M6L probably damaging Het
Mrpl9 T A 3: 94,447,766 probably null Het
Nlrp4e A T 7: 23,321,377 T430S probably benign Het
Olfr1187-ps1 T G 2: 88,540,286 noncoding transcript Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Prkce A T 17: 86,168,623 K11* probably null Het
Pros1 T C 16: 62,900,329 I117T possibly damaging Het
Prpf38b T C 3: 108,904,340 probably benign Het
Sh3rf1 T C 8: 61,372,722 S584P probably benign Het
Slit2 T C 5: 48,256,883 probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Stambp C T 6: 83,557,466 E280K probably damaging Het
Tenm3 A G 8: 48,277,746 I1329T probably damaging Het
Tex2 G A 11: 106,529,330 T869I unknown Het
Tlk2 A G 11: 105,247,564 T281A probably benign Het
Tpm1 G A 9: 67,031,945 probably benign Het
Trim3 A G 7: 105,611,189 F702L probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn2r20 T A 6: 123,385,747 T693S probably benign Het
Zfand2b A G 1: 75,169,855 K125E possibly damaging Het
Zfp747 A T 7: 127,374,590 V136D probably benign Het
Other mutations in Zfp422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp422 APN 6 116626958 missense probably benign 0.00
IGL00659:Zfp422 APN 6 116626505 nonsense probably null
IGL03199:Zfp422 APN 6 116626951 missense probably benign 0.43
R0190:Zfp422 UTSW 6 116626611 missense probably damaging 1.00
R1572:Zfp422 UTSW 6 116626784 missense probably damaging 1.00
R1756:Zfp422 UTSW 6 116626424 missense probably benign 0.00
R2290:Zfp422 UTSW 6 116626642 missense possibly damaging 0.74
R3932:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R3933:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R4700:Zfp422 UTSW 6 116626883 missense possibly damaging 0.59
R4806:Zfp422 UTSW 6 116626662 missense probably damaging 1.00
R4957:Zfp422 UTSW 6 116626943 nonsense probably null
R5784:Zfp422 UTSW 6 116626810 missense probably damaging 1.00
R6361:Zfp422 UTSW 6 116626820 missense probably damaging 1.00
R8303:Zfp422 UTSW 6 116626651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTCAGCGCACTGTCATG -3'
(R):5'- AGCAGAGCTCCAATCTCATC -3'

Sequencing Primer
(F):5'- GTCATGAAACTCCTGAAGTCTCCATG -3'
(R):5'- AGAAGCCCTACTGCTGTGATG -3'
Posted On2015-03-18