Incidental Mutation 'R3724:Nlrp4e'
ID270674
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission 040715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3724 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23321377 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 430 (T430S)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: T430S

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: T430S

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G T 8: 120,149,360 R133L probably damaging Het
Abhd8 G A 8: 71,461,492 A164V probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atl1 A G 12: 69,959,380 T487A probably damaging Het
C2cd6 C T 1: 59,066,235 probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Ccna1 T C 3: 55,050,932 E110G probably damaging Het
Ccne2 T C 4: 11,203,039 C386R probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ctdp1 C T 18: 80,459,267 V143I probably benign Het
Cyp11a1 A T 9: 58,019,322 M47L probably benign Het
Dnah5 T C 15: 28,270,420 L956P probably benign Het
Enkd1 A T 8: 105,703,925 V326E possibly damaging Het
Epha4 A G 1: 77,426,543 probably benign Het
Etv5 T C 16: 22,435,912 D66G probably damaging Het
Evi5l A G 8: 4,178,080 probably benign Het
Foxf2 A G 13: 31,630,530 K409R probably damaging Het
Frem3 A G 8: 80,615,271 T1398A probably benign Het
Galm A G 17: 80,183,280 T289A probably benign Het
Gtdc1 T C 2: 44,756,307 E44G probably damaging Het
Hmcn1 T A 1: 150,689,518 Y2286F possibly damaging Het
Iars A G 13: 49,687,384 probably null Het
Ifna5 A G 4: 88,835,934 E137G probably damaging Het
Itih4 G A 14: 30,892,584 E468K possibly damaging Het
Kat6a A T 8: 22,862,788 H196L probably damaging Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Klhl29 C T 12: 5,090,603 V680I probably damaging Het
March7 T C 2: 60,229,745 I72T probably benign Het
Mbd6 C T 10: 127,283,891 probably benign Het
Mefv A G 16: 3,708,194 probably null Het
Mindy3 T A 2: 12,355,354 M6L probably damaging Het
Mrpl9 T A 3: 94,447,766 probably null Het
Olfr1187-ps1 T G 2: 88,540,286 noncoding transcript Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Prkce A T 17: 86,168,623 K11* probably null Het
Pros1 T C 16: 62,900,329 I117T possibly damaging Het
Prpf38b T C 3: 108,904,340 probably benign Het
Sh3rf1 T C 8: 61,372,722 S584P probably benign Het
Slit2 T C 5: 48,256,883 probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Stambp C T 6: 83,557,466 E280K probably damaging Het
Tenm3 A G 8: 48,277,746 I1329T probably damaging Het
Tex2 G A 11: 106,529,330 T869I unknown Het
Tlk2 A G 11: 105,247,564 T281A probably benign Het
Tpm1 G A 9: 67,031,945 probably benign Het
Trim3 A G 7: 105,611,189 F702L probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn2r20 T A 6: 123,385,747 T693S probably benign Het
Zfand2b A G 1: 75,169,855 K125E possibly damaging Het
Zfp422 C T 6: 116,626,379 A220T probably benign Het
Zfp747 A T 7: 127,374,590 V136D probably benign Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AATCTGCCGACGTATCACTTC -3'
(R):5'- AGGCACTGATACAACTGACG -3'

Sequencing Primer
(F):5'- GACGTATCACTTCCCTGTATACCAC -3'
(R):5'- CAACTGACGTTTTATTTCTTGGGAC -3'
Posted On2015-03-18