Incidental Mutation 'R3725:Vmn2r7'
ID270719
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 040716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3725 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64724991 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 17 (F17I)
Ref Sequence ENSEMBL: ENSMUSP00000124192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050123
Predicted Effect possibly damaging
Transcript: ENSMUST00000161972
AA Change: F17I

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: F17I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,983,868 R740S possibly damaging Het
Adamtsl3 A C 7: 82,612,404 D1676A possibly damaging Het
Atp6v1a A G 16: 44,101,757 probably benign Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccdc81 A T 7: 89,866,630 F614I possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Cfh T C 1: 140,086,496 M1197V probably damaging Het
Cyp3a11 A G 5: 145,866,000 F228L probably benign Het
Ddx24 A G 12: 103,417,605 M575T probably benign Het
Dhx36 A T 3: 62,488,222 probably benign Het
Dmxl2 T A 9: 54,393,769 I1554L probably damaging Het
Dsp A G 13: 38,194,689 probably null Het
Dsp A G 13: 38,197,618 S2181G probably benign Het
Epg5 T C 18: 78,017,679 I1959T probably benign Het
Fam135a T A 1: 24,057,434 K77* probably null Het
Fam208b T C 13: 3,590,538 I200V probably benign Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fbxo11 A G 17: 88,009,286 V323A probably benign Het
Fzd5 A G 1: 64,736,339 S88P probably damaging Het
Galnt12 A T 4: 47,104,140 T133S probably damaging Het
Gja8 A G 3: 96,919,845 L167P probably damaging Het
Gm7173 T A X: 79,510,015 T285S probably damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsdmd A G 15: 75,866,090 D247G probably benign Het
Iqcg A G 16: 33,020,539 probably null Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Mlip A G 9: 77,190,380 S282P probably damaging Het
Nfxl1 A T 5: 72,517,062 D831E probably damaging Het
Nipbl T C 15: 8,295,661 D2506G probably damaging Het
Olfr1355 T A 10: 78,879,932 Y253* probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Pigc G A 1: 161,971,291 G281R possibly damaging Het
Polr3g C T 13: 81,694,635 R87H probably damaging Het
Ppfia4 T C 1: 134,313,711 D502G probably benign Het
Psg18 T A 7: 18,354,823 probably benign Het
Rad9a G A 19: 4,197,695 R179C probably damaging Het
Rxra A G 2: 27,754,277 D327G probably damaging Het
Samd7 T C 3: 30,751,134 V22A possibly damaging Het
Slc22a29 A T 19: 8,218,609 V22D possibly damaging Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Smarcb1 T A 10: 75,916,786 K73N probably benign Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Stpg2 A G 3: 139,317,477 K418R probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Uggt1 A T 1: 36,182,507 L43* probably null Het
Vmn1r205 A T 13: 22,592,501 F144I probably damaging Het
Vmn2r54 G A 7: 12,632,296 T237I probably benign Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vps13d T A 4: 145,115,648 probably benign Het
Zkscan5 A T 5: 145,220,913 R742W probably damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64691459 missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTCACTTGTTGGCATGG -3'
(R):5'- AGAGTGTTGCTCAGCTCCTATTC -3'

Sequencing Primer
(F):5'- GTTGGCATGGTCCTATAATGAACAG -3'
(R):5'- ATTGCAAGTGACTGTGACATCTG -3'
Posted On2015-03-18