Incidental Mutation 'R3725:Camsap3'
ID270735
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
MMRRC Submission 040716-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R3725 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3603785 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 485 (L485P)
Ref Sequence ENSEMBL: ENSMUSP00000146896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208036] [ENSMUST00000208240]
Predicted Effect probably damaging
Transcript: ENSMUST00000057028
AA Change: L458P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: L458P

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably benign
Transcript: ENSMUST00000171962
AA Change: L459P

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: L459P

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207077
AA Change: L474P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably damaging
Transcript: ENSMUST00000207432
AA Change: L485P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably damaging
Transcript: ENSMUST00000207970
AA Change: L469P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Meta Mutation Damage Score 0.0901 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,983,868 R740S possibly damaging Het
Adamtsl3 A C 7: 82,612,404 D1676A possibly damaging Het
Atp6v1a A G 16: 44,101,757 probably benign Het
Ccdc81 A T 7: 89,866,630 F614I possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Cfh T C 1: 140,086,496 M1197V probably damaging Het
Cyp3a11 A G 5: 145,866,000 F228L probably benign Het
Ddx24 A G 12: 103,417,605 M575T probably benign Het
Dhx36 A T 3: 62,488,222 probably benign Het
Dmxl2 T A 9: 54,393,769 I1554L probably damaging Het
Dsp A G 13: 38,194,689 probably null Het
Dsp A G 13: 38,197,618 S2181G probably benign Het
Epg5 T C 18: 78,017,679 I1959T probably benign Het
Fam135a T A 1: 24,057,434 K77* probably null Het
Fam208b T C 13: 3,590,538 I200V probably benign Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fbxo11 A G 17: 88,009,286 V323A probably benign Het
Fzd5 A G 1: 64,736,339 S88P probably damaging Het
Galnt12 A T 4: 47,104,140 T133S probably damaging Het
Gja8 A G 3: 96,919,845 L167P probably damaging Het
Gm7173 T A X: 79,510,015 T285S probably damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsdmd A G 15: 75,866,090 D247G probably benign Het
Iqcg A G 16: 33,020,539 probably null Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Mlip A G 9: 77,190,380 S282P probably damaging Het
Nfxl1 A T 5: 72,517,062 D831E probably damaging Het
Nipbl T C 15: 8,295,661 D2506G probably damaging Het
Olfr1355 T A 10: 78,879,932 Y253* probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Pigc G A 1: 161,971,291 G281R possibly damaging Het
Polr3g C T 13: 81,694,635 R87H probably damaging Het
Ppfia4 T C 1: 134,313,711 D502G probably benign Het
Psg18 T A 7: 18,354,823 probably benign Het
Rad9a G A 19: 4,197,695 R179C probably damaging Het
Rxra A G 2: 27,754,277 D327G probably damaging Het
Samd7 T C 3: 30,751,134 V22A possibly damaging Het
Slc22a29 A T 19: 8,218,609 V22D possibly damaging Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Smarcb1 T A 10: 75,916,786 K73N probably benign Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Stpg2 A G 3: 139,317,477 K418R probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Uggt1 A T 1: 36,182,507 L43* probably null Het
Vmn1r205 A T 13: 22,592,501 F144I probably damaging Het
Vmn2r54 G A 7: 12,632,296 T237I probably benign Het
Vmn2r7 A T 3: 64,724,991 F17I possibly damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vps13d T A 4: 145,115,648 probably benign Het
Zkscan5 A T 5: 145,220,913 R742W probably damaging Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3603980 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3604186 missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3608242 missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3598075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAGCTGATCAGGGCATGG -3'
(R):5'- CCTATCAGACAGCGGCTTTG -3'

Sequencing Primer
(F):5'- CTGATCAGGGCATGGCAGAG -3'
(R):5'- AGACAGCGGCTTTGAGGCTC -3'
Posted On2015-03-18