Incidental Mutation 'R3725:Dsp'
ID 270753
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Name desmoplakin
Synonyms DP, 2300002E22Rik, 5730453H04Rik, rul
MMRRC Submission 040716-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3725 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 38335270-38382553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38381594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 2181 (S2181G)
Ref Sequence ENSEMBL: ENSMUSP00000117252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000124830
AA Change: S2780G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: S2780G

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127906
AA Change: S2181G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: S2181G

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,563,781 (GRCm39) R740S possibly damaging Het
Adamtsl3 A C 7: 82,261,612 (GRCm39) D1676A possibly damaging Het
Atp6v1a A G 16: 43,922,120 (GRCm39) probably benign Het
Camsap3 T C 8: 3,653,785 (GRCm39) L485P probably damaging Het
Ccdc81 A T 7: 89,515,838 (GRCm39) F614I possibly damaging Het
Cdk5rap2 C A 4: 70,153,674 (GRCm39) K1716N possibly damaging Het
Cfap47 T A X: 78,553,621 (GRCm39) T285S probably damaging Het
Cfh T C 1: 140,014,234 (GRCm39) M1197V probably damaging Het
Cyp3a11 A G 5: 145,802,810 (GRCm39) F228L probably benign Het
Ddx24 A G 12: 103,383,864 (GRCm39) M575T probably benign Het
Dhx36 A T 3: 62,395,643 (GRCm39) probably benign Het
Dmxl2 T A 9: 54,301,053 (GRCm39) I1554L probably damaging Het
Epg5 T C 18: 78,060,894 (GRCm39) I1959T probably benign Het
Fam135a T A 1: 24,096,515 (GRCm39) K77* probably null Het
Fam209 T C 2: 172,315,915 (GRCm39) S97P probably benign Het
Fbxo11 A G 17: 88,316,714 (GRCm39) V323A probably benign Het
Fzd5 A G 1: 64,775,498 (GRCm39) S88P probably damaging Het
Galnt12 A T 4: 47,104,140 (GRCm39) T133S probably damaging Het
Gja8 A G 3: 96,827,161 (GRCm39) L167P probably damaging Het
Gm8730 T C 8: 103,591,664 (GRCm39) noncoding transcript Het
Gsdmd A G 15: 75,737,939 (GRCm39) D247G probably benign Het
Iqcg A G 16: 32,840,909 (GRCm39) probably null Het
Lamb1 C T 12: 31,371,074 (GRCm39) A1375V probably null Het
Mlip A G 9: 77,097,662 (GRCm39) S282P probably damaging Het
Nfxl1 A T 5: 72,674,405 (GRCm39) D831E probably damaging Het
Nipbl T C 15: 8,325,145 (GRCm39) D2506G probably damaging Het
Or6c212 A T 10: 129,558,984 (GRCm39) V143D probably damaging Het
Or7a39 T A 10: 78,715,766 (GRCm39) Y253* probably null Het
Pcdhb9 T C 18: 37,534,654 (GRCm39) L216P possibly damaging Het
Pigc G A 1: 161,798,860 (GRCm39) G281R possibly damaging Het
Polr3g C T 13: 81,842,754 (GRCm39) R87H probably damaging Het
Ppfia4 T C 1: 134,241,449 (GRCm39) D502G probably benign Het
Psg18 T A 7: 18,088,748 (GRCm39) probably benign Het
Rad9a G A 19: 4,247,694 (GRCm39) R179C probably damaging Het
Rxra A G 2: 27,644,289 (GRCm39) D327G probably damaging Het
Samd7 T C 3: 30,805,283 (GRCm39) V22A possibly damaging Het
Slc22a29 A T 19: 8,195,973 (GRCm39) V22D possibly damaging Het
Slmap C A 14: 26,148,397 (GRCm39) R671S probably damaging Het
Smarcal1 T C 1: 72,665,755 (GRCm39) F751S possibly damaging Het
Smarcb1 T A 10: 75,752,620 (GRCm39) K73N probably benign Het
Sptssa T C 12: 54,703,180 (GRCm39) E30G probably damaging Het
Stpg2 A G 3: 139,023,238 (GRCm39) K418R probably benign Het
Tasor2 T C 13: 3,640,538 (GRCm39) I200V probably benign Het
Tmem19 A G 10: 115,195,675 (GRCm39) probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Tmod1 T C 4: 46,097,026 (GRCm39) V273A probably benign Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Uggt1 A T 1: 36,221,588 (GRCm39) L43* probably null Het
Vmn1r205 A T 13: 22,776,671 (GRCm39) F144I probably damaging Het
Vmn2r54 G A 7: 12,366,223 (GRCm39) T237I probably benign Het
Vmn2r7 A T 3: 64,632,412 (GRCm39) F17I possibly damaging Het
Vpreb3 G A 10: 75,779,125 (GRCm39) probably null Het
Vps13d T A 4: 144,842,218 (GRCm39) probably benign Het
Zkscan5 A T 5: 145,157,723 (GRCm39) R742W probably damaging Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38,381,822 (GRCm39) missense probably damaging 0.99
IGL01337:Dsp APN 13 38,376,663 (GRCm39) missense probably benign 0.44
IGL01371:Dsp APN 13 38,377,593 (GRCm39) missense probably benign 0.13
IGL01473:Dsp APN 13 38,351,547 (GRCm39) missense probably damaging 0.99
IGL01660:Dsp APN 13 38,360,471 (GRCm39) missense possibly damaging 0.90
IGL01723:Dsp APN 13 38,363,060 (GRCm39) missense probably damaging 1.00
IGL01999:Dsp APN 13 38,365,162 (GRCm39) missense probably damaging 0.99
IGL02313:Dsp APN 13 38,380,499 (GRCm39) nonsense probably null
IGL02833:Dsp APN 13 38,376,897 (GRCm39) missense possibly damaging 0.56
IGL03050:Dsp APN 13 38,372,421 (GRCm39) splice site probably benign
IGL03353:Dsp APN 13 38,370,671 (GRCm39) missense probably damaging 1.00
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0078:Dsp UTSW 13 38,379,993 (GRCm39) missense probably benign 0.22
R0230:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign 0.03
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0285:Dsp UTSW 13 38,356,770 (GRCm39) missense probably benign
R0326:Dsp UTSW 13 38,376,846 (GRCm39) nonsense probably null
R0332:Dsp UTSW 13 38,366,204 (GRCm39) nonsense probably null
R0471:Dsp UTSW 13 38,377,326 (GRCm39) nonsense probably null
R0567:Dsp UTSW 13 38,376,414 (GRCm39) missense probably benign 0.01
R0611:Dsp UTSW 13 38,371,717 (GRCm39) missense probably damaging 1.00
R0718:Dsp UTSW 13 38,380,740 (GRCm39) missense possibly damaging 0.80
R0926:Dsp UTSW 13 38,367,194 (GRCm39) missense probably damaging 0.97
R1078:Dsp UTSW 13 38,367,082 (GRCm39) splice site probably benign
R1183:Dsp UTSW 13 38,375,716 (GRCm39) nonsense probably null
R1188:Dsp UTSW 13 38,378,939 (GRCm39) missense probably damaging 1.00
R1419:Dsp UTSW 13 38,370,671 (GRCm39) missense probably damaging 1.00
R1445:Dsp UTSW 13 38,375,907 (GRCm39) missense probably damaging 0.98
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1478:Dsp UTSW 13 38,365,114 (GRCm39) missense probably damaging 1.00
R1568:Dsp UTSW 13 38,359,123 (GRCm39) missense probably damaging 1.00
R1572:Dsp UTSW 13 38,379,714 (GRCm39) missense probably damaging 1.00
R1676:Dsp UTSW 13 38,377,350 (GRCm39) nonsense probably null
R1736:Dsp UTSW 13 38,376,966 (GRCm39) missense probably benign 0.01
R1776:Dsp UTSW 13 38,380,593 (GRCm39) missense probably damaging 0.99
R1829:Dsp UTSW 13 38,377,171 (GRCm39) missense probably damaging 1.00
R1878:Dsp UTSW 13 38,348,831 (GRCm39) missense possibly damaging 0.53
R2013:Dsp UTSW 13 38,375,434 (GRCm39) missense probably damaging 1.00
R2161:Dsp UTSW 13 38,380,427 (GRCm39) missense probably damaging 1.00
R2187:Dsp UTSW 13 38,360,383 (GRCm39) missense probably damaging 1.00
R2295:Dsp UTSW 13 38,381,022 (GRCm39) missense probably benign 0.28
R2495:Dsp UTSW 13 38,377,453 (GRCm39) missense possibly damaging 0.91
R2566:Dsp UTSW 13 38,380,380 (GRCm39) missense probably damaging 1.00
R2888:Dsp UTSW 13 38,376,224 (GRCm39) missense possibly damaging 0.92
R3012:Dsp UTSW 13 38,377,318 (GRCm39) missense possibly damaging 0.61
R3614:Dsp UTSW 13 38,361,175 (GRCm39) missense probably damaging 0.98
R3725:Dsp UTSW 13 38,378,665 (GRCm39) splice site probably null
R3797:Dsp UTSW 13 38,361,260 (GRCm39) critical splice donor site probably null
R3841:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign
R4030:Dsp UTSW 13 38,375,404 (GRCm39) missense possibly damaging 0.84
R4124:Dsp UTSW 13 38,370,689 (GRCm39) missense probably damaging 1.00
R4279:Dsp UTSW 13 38,369,207 (GRCm39) missense probably damaging 1.00
R4334:Dsp UTSW 13 38,380,640 (GRCm39) missense possibly damaging 0.46
R4419:Dsp UTSW 13 38,379,108 (GRCm39) missense probably damaging 1.00
R4615:Dsp UTSW 13 38,375,608 (GRCm39) missense probably damaging 0.98
R4627:Dsp UTSW 13 38,352,617 (GRCm39) missense probably benign 0.01
R4639:Dsp UTSW 13 38,380,760 (GRCm39) missense probably damaging 1.00
R4687:Dsp UTSW 13 38,375,595 (GRCm39) missense probably damaging 1.00
R4735:Dsp UTSW 13 38,380,016 (GRCm39) missense probably damaging 0.99
R4746:Dsp UTSW 13 38,379,080 (GRCm39) missense possibly damaging 0.51
R4772:Dsp UTSW 13 38,351,504 (GRCm39) nonsense probably null
R4830:Dsp UTSW 13 38,376,840 (GRCm39) missense probably benign
R4850:Dsp UTSW 13 38,376,445 (GRCm39) missense probably damaging 1.00
R4959:Dsp UTSW 13 38,375,686 (GRCm39) missense probably benign 0.41
R4963:Dsp UTSW 13 38,381,846 (GRCm39) missense probably damaging 0.99
R4969:Dsp UTSW 13 38,376,886 (GRCm39) missense probably benign 0.00
R4978:Dsp UTSW 13 38,366,210 (GRCm39) missense probably damaging 1.00
R4989:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5068:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5069:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5070:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5133:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5138:Dsp UTSW 13 38,379,821 (GRCm39) missense possibly damaging 0.50
R5138:Dsp UTSW 13 38,367,274 (GRCm39) missense probably benign 0.37
R5153:Dsp UTSW 13 38,366,282 (GRCm39) missense probably damaging 1.00
R5199:Dsp UTSW 13 38,376,878 (GRCm39) nonsense probably null
R5226:Dsp UTSW 13 38,370,746 (GRCm39) missense probably damaging 0.99
R5265:Dsp UTSW 13 38,379,159 (GRCm39) missense possibly damaging 0.95
R5371:Dsp UTSW 13 38,378,865 (GRCm39) missense probably damaging 0.97
R5484:Dsp UTSW 13 38,368,014 (GRCm39) missense possibly damaging 0.48
R5534:Dsp UTSW 13 38,379,818 (GRCm39) missense probably benign 0.01
R5569:Dsp UTSW 13 38,376,628 (GRCm39) missense probably benign 0.01
R5854:Dsp UTSW 13 38,351,477 (GRCm39) splice site probably null
R5910:Dsp UTSW 13 38,376,445 (GRCm39) missense possibly damaging 0.95
R5929:Dsp UTSW 13 38,379,410 (GRCm39) missense possibly damaging 0.92
R5940:Dsp UTSW 13 38,380,002 (GRCm39) missense possibly damaging 0.70
R5948:Dsp UTSW 13 38,379,377 (GRCm39) missense possibly damaging 0.95
R5955:Dsp UTSW 13 38,378,934 (GRCm39) missense possibly damaging 0.73
R5970:Dsp UTSW 13 38,379,678 (GRCm39) missense possibly damaging 0.93
R6054:Dsp UTSW 13 38,351,585 (GRCm39) missense probably benign 0.00
R6113:Dsp UTSW 13 38,376,023 (GRCm39) missense probably damaging 1.00
R6139:Dsp UTSW 13 38,376,382 (GRCm39) missense probably damaging 0.97
R6328:Dsp UTSW 13 38,380,982 (GRCm39) nonsense probably null
R6527:Dsp UTSW 13 38,379,849 (GRCm39) missense probably damaging 1.00
R6573:Dsp UTSW 13 38,380,838 (GRCm39) missense probably damaging 1.00
R6628:Dsp UTSW 13 38,351,598 (GRCm39) missense possibly damaging 0.73
R6738:Dsp UTSW 13 38,376,186 (GRCm39) missense possibly damaging 0.87
R6898:Dsp UTSW 13 38,376,193 (GRCm39) missense possibly damaging 0.59
R6919:Dsp UTSW 13 38,351,631 (GRCm39) missense possibly damaging 0.84
R6951:Dsp UTSW 13 38,351,622 (GRCm39) missense possibly damaging 0.95
R7017:Dsp UTSW 13 38,370,683 (GRCm39) missense probably benign 0.02
R7022:Dsp UTSW 13 38,375,716 (GRCm39) missense probably benign 0.06
R7135:Dsp UTSW 13 38,363,049 (GRCm39) missense probably damaging 1.00
R7192:Dsp UTSW 13 38,379,569 (GRCm39) missense probably benign 0.09
R7211:Dsp UTSW 13 38,372,511 (GRCm39) critical splice donor site probably null
R7251:Dsp UTSW 13 38,377,524 (GRCm39) missense probably benign 0.02
R7326:Dsp UTSW 13 38,376,859 (GRCm39) missense probably benign 0.01
R7369:Dsp UTSW 13 38,381,501 (GRCm39) missense possibly damaging 0.82
R7376:Dsp UTSW 13 38,356,819 (GRCm39) missense probably damaging 1.00
R7406:Dsp UTSW 13 38,381,172 (GRCm39) missense possibly damaging 0.63
R7439:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7439:Dsp UTSW 13 38,360,478 (GRCm39) critical splice donor site probably null
R7441:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7477:Dsp UTSW 13 38,356,839 (GRCm39) missense probably damaging 1.00
R7535:Dsp UTSW 13 38,376,765 (GRCm39) missense probably benign 0.05
R7558:Dsp UTSW 13 38,352,742 (GRCm39) missense probably benign 0.02
R7600:Dsp UTSW 13 38,375,691 (GRCm39) missense probably damaging 1.00
R7616:Dsp UTSW 13 38,375,458 (GRCm39) missense probably damaging 0.98
R7702:Dsp UTSW 13 38,359,183 (GRCm39) missense possibly damaging 0.83
R7738:Dsp UTSW 13 38,369,151 (GRCm39) missense probably damaging 0.97
R7815:Dsp UTSW 13 38,375,446 (GRCm39) missense probably benign 0.31
R7882:Dsp UTSW 13 38,367,994 (GRCm39) missense possibly damaging 0.76
R7917:Dsp UTSW 13 38,351,615 (GRCm39) nonsense probably null
R7971:Dsp UTSW 13 38,376,499 (GRCm39) missense probably damaging 0.97
R8104:Dsp UTSW 13 38,352,600 (GRCm39) missense probably benign 0.03
R8176:Dsp UTSW 13 38,376,786 (GRCm39) missense possibly damaging 0.56
R8303:Dsp UTSW 13 38,381,319 (GRCm39) missense probably benign
R8323:Dsp UTSW 13 38,356,806 (GRCm39) missense possibly damaging 0.80
R8326:Dsp UTSW 13 38,375,611 (GRCm39) missense probably damaging 1.00
R8358:Dsp UTSW 13 38,376,457 (GRCm39) missense possibly damaging 0.92
R8410:Dsp UTSW 13 38,380,791 (GRCm39) missense possibly damaging 0.94
R8552:Dsp UTSW 13 38,369,117 (GRCm39) missense probably damaging 0.98
R8713:Dsp UTSW 13 38,352,701 (GRCm39) missense probably damaging 0.99
R8801:Dsp UTSW 13 38,381,502 (GRCm39) missense possibly damaging 0.81
R8900:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8901:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8968:Dsp UTSW 13 38,335,596 (GRCm39) missense possibly damaging 0.83
R9014:Dsp UTSW 13 38,376,700 (GRCm39) missense possibly damaging 0.83
R9021:Dsp UTSW 13 38,380,808 (GRCm39) missense possibly damaging 0.61
R9030:Dsp UTSW 13 38,352,673 (GRCm39) missense probably damaging 1.00
R9124:Dsp UTSW 13 38,377,276 (GRCm39) missense probably benign 0.42
R9129:Dsp UTSW 13 38,377,126 (GRCm39) missense probably benign 0.09
R9143:Dsp UTSW 13 38,377,337 (GRCm39) missense probably benign 0.05
R9450:Dsp UTSW 13 38,376,379 (GRCm39) missense probably damaging 1.00
R9488:Dsp UTSW 13 38,377,218 (GRCm39) missense probably benign 0.04
R9514:Dsp UTSW 13 38,371,781 (GRCm39) missense probably benign 0.02
R9789:Dsp UTSW 13 38,367,937 (GRCm39) missense probably benign 0.03
R9792:Dsp UTSW 13 38,379,494 (GRCm39) missense possibly damaging 0.87
X0023:Dsp UTSW 13 38,381,660 (GRCm39) missense probably benign 0.00
X0024:Dsp UTSW 13 38,377,231 (GRCm39) missense probably benign 0.04
X0027:Dsp UTSW 13 38,370,622 (GRCm39) missense possibly damaging 0.68
X0067:Dsp UTSW 13 38,366,288 (GRCm39) missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38,381,166 (GRCm39) missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38,376,830 (GRCm39) frame shift probably null
Z1177:Dsp UTSW 13 38,335,665 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGTCAAAGAGAAATGGCTTC -3'
(R):5'- AGCATCGAAGCTTCCTCTCC -3'

Sequencing Primer
(F):5'- AGAAATGGCTTCCCTACGAGGC -3'
(R):5'- GAGATCCGGACCTTGAACCAG -3'
Posted On 2015-03-18