Incidental Mutation 'R3725:Fbxo11'
ID270759
Institutional Source Beutler Lab
Gene Symbol Fbxo11
Ensembl Gene ENSMUSG00000005371
Gene NameF-box protein 11
SynonymsJf, GENA 104
MMRRC Submission 040716-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3725 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location87990859-88065291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88009286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 323 (V323A)
Ref Sequence ENSEMBL: ENSMUSP00000005504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005504]
Predicted Effect probably benign
Transcript: ENSMUST00000005504
AA Change: V323A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371
AA Change: V323A

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130379
AA Change: V247A
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371
AA Change: V247A

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135639
Meta Mutation Damage Score 0.1241 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cleft palate, facial clefting, and perinatal lethality. Mice homozygous for a knock-out allele show neonatal lethality, thick epidermis, decreased hair follicle number, absent keratohyalin granules, and increased epidermal Snail protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,983,868 R740S possibly damaging Het
Adamtsl3 A C 7: 82,612,404 D1676A possibly damaging Het
Atp6v1a A G 16: 44,101,757 probably benign Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccdc81 A T 7: 89,866,630 F614I possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Cfh T C 1: 140,086,496 M1197V probably damaging Het
Cyp3a11 A G 5: 145,866,000 F228L probably benign Het
Ddx24 A G 12: 103,417,605 M575T probably benign Het
Dhx36 A T 3: 62,488,222 probably benign Het
Dmxl2 T A 9: 54,393,769 I1554L probably damaging Het
Dsp A G 13: 38,194,689 probably null Het
Dsp A G 13: 38,197,618 S2181G probably benign Het
Epg5 T C 18: 78,017,679 I1959T probably benign Het
Fam135a T A 1: 24,057,434 K77* probably null Het
Fam208b T C 13: 3,590,538 I200V probably benign Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fzd5 A G 1: 64,736,339 S88P probably damaging Het
Galnt12 A T 4: 47,104,140 T133S probably damaging Het
Gja8 A G 3: 96,919,845 L167P probably damaging Het
Gm7173 T A X: 79,510,015 T285S probably damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsdmd A G 15: 75,866,090 D247G probably benign Het
Iqcg A G 16: 33,020,539 probably null Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Mlip A G 9: 77,190,380 S282P probably damaging Het
Nfxl1 A T 5: 72,517,062 D831E probably damaging Het
Nipbl T C 15: 8,295,661 D2506G probably damaging Het
Olfr1355 T A 10: 78,879,932 Y253* probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Pigc G A 1: 161,971,291 G281R possibly damaging Het
Polr3g C T 13: 81,694,635 R87H probably damaging Het
Ppfia4 T C 1: 134,313,711 D502G probably benign Het
Psg18 T A 7: 18,354,823 probably benign Het
Rad9a G A 19: 4,197,695 R179C probably damaging Het
Rxra A G 2: 27,754,277 D327G probably damaging Het
Samd7 T C 3: 30,751,134 V22A possibly damaging Het
Slc22a29 A T 19: 8,218,609 V22D possibly damaging Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Smarcb1 T A 10: 75,916,786 K73N probably benign Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Stpg2 A G 3: 139,317,477 K418R probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Uggt1 A T 1: 36,182,507 L43* probably null Het
Vmn1r205 A T 13: 22,592,501 F144I probably damaging Het
Vmn2r54 G A 7: 12,632,296 T237I probably benign Het
Vmn2r7 A T 3: 64,724,991 F17I possibly damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vps13d T A 4: 145,115,648 probably benign Het
Zkscan5 A T 5: 145,220,913 R742W probably damaging Het
Other mutations in Fbxo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Fbxo11 APN 17 88002896 missense probably benign 0.02
IGL01908:Fbxo11 APN 17 87992300 missense probably benign 0.10
IGL02012:Fbxo11 APN 17 88012651 missense probably benign 0.00
IGL02149:Fbxo11 APN 17 87993759 missense possibly damaging 0.85
IGL02223:Fbxo11 APN 17 88009286 missense probably benign 0.03
IGL02586:Fbxo11 APN 17 88011283 unclassified probably benign
IGL03265:Fbxo11 APN 17 87992831 missense probably damaging 1.00
R0184:Fbxo11 UTSW 17 88008673 missense probably benign 0.19
R0335:Fbxo11 UTSW 17 88015613 missense possibly damaging 0.90
R0918:Fbxo11 UTSW 17 87997603 missense probably damaging 1.00
R1658:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R4194:Fbxo11 UTSW 17 88009108 missense possibly damaging 0.94
R4884:Fbxo11 UTSW 17 87992333 missense probably damaging 0.99
R4902:Fbxo11 UTSW 17 88065274 unclassified probably benign
R5651:Fbxo11 UTSW 17 88015708 missense probably benign 0.01
R6137:Fbxo11 UTSW 17 88008669 missense probably benign 0.00
R6217:Fbxo11 UTSW 17 88008904 missense probably benign 0.00
R6482:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R7383:Fbxo11 UTSW 17 88002854 missense
R7813:Fbxo11 UTSW 17 88000817 missense
R7823:Fbxo11 UTSW 17 87993182 missense probably damaging 0.98
RF002:Fbxo11 UTSW 17 87996053 missense
X0060:Fbxo11 UTSW 17 87992306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGATTTGTCATCAGGGTTG -3'
(R):5'- AGTGTTCACTACTGCTTTAAACACC -3'

Sequencing Primer
(F):5'- TTGTCATCAGGGTTGAACTGAAAAG -3'
(R):5'- TCTCAGCTAGACATGGCGATG -3'
Posted On2015-03-18