Incidental Mutation 'R3726:Galnt13'
ID270773
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
MMRRC Submission 040717-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R3726 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55098657 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 497 (H497R)
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect probably damaging
Transcript: ENSMUST00000068595
AA Change: H497R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: H497R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112634
AA Change: H533R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: H533R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112635
AA Change: H497R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: H497R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112636
AA Change: H497R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: H497R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Meta Mutation Damage Score 0.3587 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402K13Rik AGAGGAG AGAG X: 9,105,103 probably benign Het
Caap1 A T 4: 94,501,143 V318D probably damaging Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccsap T C 8: 123,859,361 E17G possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Coq3 T C 4: 21,892,941 probably benign Het
Daam2 T A 17: 49,469,738 D773V probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fam50b G A 13: 34,746,886 R115H probably damaging Het
Fbxo31 A G 8: 121,578,509 F83L probably damaging Het
Fsip2 G T 2: 82,988,967 A5015S possibly damaging Het
Ggnbp2 A G 11: 84,854,094 C201R possibly damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsr A G 8: 33,671,537 K124R probably benign Het
Hdgf T C 3: 87,914,497 S140P probably benign Het
Iqcg C T 16: 33,029,041 E292K probably damaging Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lonp1 A G 17: 56,618,310 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Ppp3cb A G 14: 20,530,942 probably null Het
Ptprm G A 17: 66,956,860 P464L possibly damaging Het
Rars2 A G 4: 34,645,787 T235A probably benign Het
Rimkla A T 4: 119,477,789 probably null Het
Rnf216 A T 5: 143,027,946 I708N probably damaging Het
Six5 T A 7: 19,096,930 V494E possibly damaging Het
Slc43a2 A G 11: 75,543,154 probably benign Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Sptan1 G A 2: 30,018,419 D1711N possibly damaging Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Taf1c A G 8: 119,603,070 F111L probably damaging Het
Thbs1 A G 2: 118,114,710 I255V probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Trpm8 A T 1: 88,328,196 Y191F probably benign Het
Ube4a T C 9: 44,933,323 I934V probably damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vwf G T 6: 125,677,948 probably benign Het
Wdr53 T C 16: 32,256,720 C248R probably benign Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8525:Galnt13 UTSW 2 55060476 missense possibly damaging 0.95
R8539:Galnt13 UTSW 2 54933572 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGACGTTTCCAGAGACACCTC -3'
(R):5'- AAGTATCCTCCTGTTAGTCTTATTGGG -3'

Sequencing Primer
(F):5'- CTGCTAAAGAGTGTGTTTTCTCAACC -3'
(R):5'- CCAGATACCATAATTGCAAG -3'
Posted On2015-03-18