Incidental Mutation 'R3726:Cdk5rap2'
ID 270782
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms 2900018K03Rik, an
MMRRC Submission 040717-MU
Accession Numbers

Genbank: NM_145990.3
Essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R3726 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 70216856-70410443 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70235437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1716 (K1716N)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144099
AA Change: K1716N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: K1716N

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402K13Rik AGAGGAG AGAG X: 9,105,103 probably benign Het
Caap1 A T 4: 94,501,143 V318D probably damaging Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccsap T C 8: 123,859,361 E17G possibly damaging Het
Coq3 T C 4: 21,892,941 probably benign Het
Daam2 T A 17: 49,469,738 D773V probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fam50b G A 13: 34,746,886 R115H probably damaging Het
Fbxo31 A G 8: 121,578,509 F83L probably damaging Het
Fsip2 G T 2: 82,988,967 A5015S possibly damaging Het
Galnt13 A G 2: 55,098,657 H497R probably damaging Het
Ggnbp2 A G 11: 84,854,094 C201R possibly damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsr A G 8: 33,671,537 K124R probably benign Het
Hdgf T C 3: 87,914,497 S140P probably benign Het
Iqcg C T 16: 33,029,041 E292K probably damaging Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lonp1 A G 17: 56,618,310 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Ppp3cb A G 14: 20,530,942 probably null Het
Ptprm G A 17: 66,956,860 P464L possibly damaging Het
Rars2 A G 4: 34,645,787 T235A probably benign Het
Rimkla A T 4: 119,477,789 probably null Het
Rnf216 A T 5: 143,027,946 I708N probably damaging Het
Six5 T A 7: 19,096,930 V494E possibly damaging Het
Slc43a2 A G 11: 75,543,154 probably benign Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Sptan1 G A 2: 30,018,419 D1711N possibly damaging Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Taf1c A G 8: 119,603,070 F111L probably damaging Het
Thbs1 A G 2: 118,114,710 I255V probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Trpm8 A T 1: 88,328,196 Y191F probably benign Het
Ube4a T C 9: 44,933,323 I934V probably damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vwf G T 6: 125,677,948 probably benign Het
Wdr53 T C 16: 32,256,720 C248R probably benign Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70380273 missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70239325 missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70245510 splice site probably benign
R8782:Cdk5rap2 UTSW 4 70243475 missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70300650 missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70266805 missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70337346 missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70410267 start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70254666 missense possibly damaging 0.75
R9396:Cdk5rap2 UTSW 4 70264658 missense probably damaging 0.97
R9507:Cdk5rap2 UTSW 4 70291873 missense probably benign
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACTTAGTGTGGCCCCAAC -3'
(R):5'- CAGCTCCTGATCCTGAAACAG -3'

Sequencing Primer
(F):5'- TCTGACACATCCCCAAGGTGG -3'
(R):5'- CTGAAACAGGAGCCCTAGTCTG -3'
Posted On 2015-03-18