Incidental Mutation 'R3727:Styxl2'
ID 270816
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 040718-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3727 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 165927075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 846 (R846C)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: R846C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: R846C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: R846C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: R846C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.1494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 72,985,706 (GRCm39) V630M probably damaging Het
Alk T C 17: 72,208,395 (GRCm39) probably benign Het
Atp6v0a1 T A 11: 100,921,246 (GRCm39) S243T probably benign Het
BC035044 C A 6: 128,867,822 (GRCm39) G37* probably null Het
C3 G T 17: 57,514,379 (GRCm39) N1435K possibly damaging Het
Caly T C 7: 139,650,417 (GRCm39) E175G probably damaging Het
Ccng2 T C 5: 93,422,810 (GRCm39) F330S probably damaging Het
Cemip2 G A 19: 21,822,075 (GRCm39) A1157T probably benign Het
Cyp2c38 A G 19: 39,380,739 (GRCm39) probably benign Het
Cypt1 T A X: 16,389,674 (GRCm39) L128* probably null Het
Dmgdh A G 13: 93,828,575 (GRCm39) N239D probably damaging Het
Dnah8 C T 17: 30,958,622 (GRCm39) Q2155* probably null Het
Dpp3 A G 19: 4,973,213 (GRCm39) I127T probably benign Het
Eps15 G T 4: 109,227,882 (GRCm39) probably benign Het
Exosc10 A G 4: 148,649,734 (GRCm39) D388G probably damaging Het
Flt3 C A 5: 147,291,733 (GRCm39) R572S probably damaging Het
Gm44501 T C 17: 40,887,506 (GRCm39) F8S unknown Het
Hormad2 C A 11: 4,358,598 (GRCm39) G270C probably benign Het
Ifrd2 C T 9: 107,468,881 (GRCm39) R40* probably null Het
Ina G A 19: 47,004,158 (GRCm39) R322H possibly damaging Het
Kif13b A G 14: 65,003,197 (GRCm39) probably benign Het
Lrp2 T C 2: 69,340,773 (GRCm39) N1034S probably damaging Het
Macf1 T A 4: 123,353,104 (GRCm39) E1770V probably damaging Het
Mpi T C 9: 57,452,132 (GRCm39) I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nt5c C T 11: 115,381,474 (GRCm39) W185* probably null Het
Or2j3 A T 17: 38,616,310 (GRCm39) I14N possibly damaging Het
Or2y1e G A 11: 49,218,622 (GRCm39) R128H probably benign Het
Pcdhga9 G A 18: 37,871,995 (GRCm39) R608H probably benign Het
Pdzrn3 T A 6: 101,133,906 (GRCm39) D441V probably damaging Het
Rab42 A G 4: 132,029,964 (GRCm39) M86T probably benign Het
Slc52a3 C T 2: 151,847,701 (GRCm39) P270S probably benign Het
Stpg2 T C 3: 139,004,257 (GRCm39) F278S probably damaging Het
Tmem240 T C 4: 155,824,235 (GRCm39) probably benign Het
Vmn2r22 A G 6: 123,627,584 (GRCm39) L4P possibly damaging Het
Vmn2r95 C T 17: 18,661,744 (GRCm39) Q497* probably null Het
Wnk1 T C 6: 119,969,414 (GRCm39) H347R probably damaging Het
Zmym2 A T 14: 57,156,806 (GRCm39) probably benign Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCGGCCATTTCTATAGTG -3'
(R):5'- TGCAAGCATGAAGGCAGCTC -3'

Sequencing Primer
(F):5'- CGGCCATTTCTATAGTGATCAGAG -3'
(R):5'- CATGAAGGCAGCTCCAGCAG -3'
Posted On 2015-03-18