Incidental Mutation 'R3727:Dusp27'
ID270816
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 166099506 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 846 (R846C)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
Predicted Effect probably damaging
Transcript: ENSMUST00000085992
AA Change: R846C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: R846C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192369
AA Change: R846C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: R846C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Meta Mutation Damage Score 0.1494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R0542:Dusp27 UTSW 1 166101284 missense possibly damaging 0.90
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4955:Dusp27 UTSW 1 166108092 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6222:Dusp27 UTSW 1 166098645 missense probably benign 0.26
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R6958:Dusp27 UTSW 1 166107996 missense probably damaging 1.00
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7312:Dusp27 UTSW 1 166127107 missense probably damaging 0.99
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7569:Dusp27 UTSW 1 166108035 missense probably damaging 1.00
R7920:Dusp27 UTSW 1 166099896 missense possibly damaging 0.72
R7954:Dusp27 UTSW 1 166099280 missense probably benign 0.05
R7972:Dusp27 UTSW 1 166099139 missense probably damaging 1.00
R8186:Dusp27 UTSW 1 166100079 missense probably damaging 1.00
R8354:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8454:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8535:Dusp27 UTSW 1 166101161 missense probably benign 0.01
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCGGCCATTTCTATAGTG -3'
(R):5'- TGCAAGCATGAAGGCAGCTC -3'

Sequencing Primer
(F):5'- CGGCCATTTCTATAGTGATCAGAG -3'
(R):5'- CATGAAGGCAGCTCCAGCAG -3'
Posted On2015-03-18