Incidental Mutation 'R3727:Tmem240'
ID270826
Institutional Source Beutler Lab
Gene Symbol Tmem240
Ensembl Gene ENSMUSG00000084845
Gene Nametransmembrane protein 240
SynonymsGm5151
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3727 (G1)
Quality Score224
Status Validated
Chromosome4
Chromosomal Location155734800-155740564 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 155739778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000127188] [ENSMUST00000147721]
Predicted Effect probably benign
Transcript: ENSMUST00000030903
SMART Domains Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 26 285 9.5e-113 PFAM
AAA 343 482 4.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126725
Predicted Effect probably benign
Transcript: ENSMUST00000127188
SMART Domains Protein: ENSMUSP00000127341
Gene: ENSMUSG00000084845

DomainStartEndE-ValueType
Pfam:TMEM240 1 173 3.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147721
SMART Domains Protein: ENSMUSP00000130974
Gene: ENSMUSG00000084845

DomainStartEndE-ValueType
Pfam:TMEM240 1 173 1.5e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176526
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane-domain containing protein found in the brain and cerebellum. Mutations in this gene result in spinocerebellar ataxia 21. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Tmem240
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1995:Tmem240 UTSW 4 155739847 missense possibly damaging 0.84
R2027:Tmem240 UTSW 4 155735435 missense possibly damaging 0.94
R5023:Tmem240 UTSW 4 155739674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACGCCTCTGAGAACTAC -3'
(R):5'- CTTTATATGTGCACGGCAGC -3'

Sequencing Primer
(F):5'- GCCTCTGAGAACTACTTTGTGACAG -3'
(R):5'- AGTCCTGGGCACTCAGAG -3'
Posted On2015-03-18