Incidental Mutation 'R3727:Hormad2'
ID270839
Institutional Source Beutler Lab
Gene Symbol Hormad2
Ensembl Gene ENSMUSG00000020419
Gene NameHORMA domain containing 2
Synonyms
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4345814-4441105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4408598 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 270 (G270C)
Ref Sequence ENSEMBL: ENSMUSP00000105575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020689] [ENSMUST00000109948] [ENSMUST00000109949]
Predicted Effect probably benign
Transcript: ENSMUST00000020689
SMART Domains Protein: ENSMUSP00000020689
Gene: ENSMUSG00000020419

DomainStartEndE-ValueType
Pfam:HORMA 27 65 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109948
AA Change: G270C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105574
Gene: ENSMUSG00000020419
AA Change: G270C

DomainStartEndE-ValueType
Pfam:HORMA 28 226 8.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109949
AA Change: G270C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105575
Gene: ENSMUSG00000020419
AA Change: G270C

DomainStartEndE-ValueType
Pfam:HORMA 27 226 6.4e-60 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to arrest of spermatogenesis, male infertility, and abnormalities in male and female meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Hormad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02245:Hormad2 APN 11 4408580 splice site probably benign
R0116:Hormad2 UTSW 11 4412206 splice site probably benign
R0504:Hormad2 UTSW 11 4408833 missense possibly damaging 0.78
R0925:Hormad2 UTSW 11 4427297 missense probably damaging 1.00
R1344:Hormad2 UTSW 11 4409005 critical splice donor site probably null
R1418:Hormad2 UTSW 11 4409005 critical splice donor site probably null
R1512:Hormad2 UTSW 11 4424788 missense probably damaging 1.00
R1562:Hormad2 UTSW 11 4408848 splice site probably null
R2158:Hormad2 UTSW 11 4424808 nonsense probably null
R3405:Hormad2 UTSW 11 4424302 missense probably damaging 1.00
R3903:Hormad2 UTSW 11 4427237 splice site probably benign
R6277:Hormad2 UTSW 11 4421583 splice site probably null
R7468:Hormad2 UTSW 11 4412245 nonsense probably null
R7633:Hormad2 UTSW 11 4346662 missense probably benign 0.00
R7912:Hormad2 UTSW 11 4408841 missense probably damaging 1.00
R7993:Hormad2 UTSW 11 4408841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTATTGAGTATGAACAAACCCG -3'
(R):5'- AGCCTGTGAGCCTTCGAATG -3'

Sequencing Primer
(F):5'- GAGTATGAACAAACCCGATACTTAG -3'
(R):5'- AGCCTTCGAATGGGTTCAGTCTC -3'
Posted On2015-03-18