Incidental Mutation 'R3727:Ago2'
ID270846
Institutional Source Beutler Lab
Gene Symbol Ago2
Ensembl Gene ENSMUSG00000036698
Gene Nameargonaute RISC catalytic subunit 2
Synonyms2310051F07Rik, argonaute 2, Eif2c2, 1110029L17Rik
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73095844-73184935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73113857 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 630 (V630M)
Ref Sequence ENSEMBL: ENSMUSP00000042207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044113]
Predicted Effect probably damaging
Transcript: ENSMUST00000044113
AA Change: V630M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042207
Gene: ENSMUSG00000036698
AA Change: V630M

DomainStartEndE-ValueType
Pfam:ArgoN 29 167 1.7e-29 PFAM
DUF1785 176 228 2.98e-24 SMART
PAZ 236 371 3.11e-4 SMART
Pfam:ArgoL2 376 421 8.7e-16 PFAM
Pfam:ArgoMid 430 512 2.9e-35 PFAM
Piwi 518 819 1.36e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230158
Meta Mutation Damage Score 0.7935 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality with neural tube defects, abnormal forebrain patterning, enlarged hearts, pericardial swelling, delayed development, and defects in the yolk sac and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Ago2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ago2 APN 15 73126453 missense probably benign 0.00
IGL01642:Ago2 APN 15 73123390 missense probably benign 0.00
IGL02017:Ago2 APN 15 73126517 missense probably benign 0.15
IGL02246:Ago2 APN 15 73108418 missense probably damaging 1.00
IGL02434:Ago2 APN 15 73121081 missense probably damaging 1.00
IGL02674:Ago2 APN 15 73111794 missense probably damaging 1.00
IGL02686:Ago2 APN 15 73113742 missense possibly damaging 0.95
IGL02716:Ago2 APN 15 73111727 missense possibly damaging 0.94
IGL02751:Ago2 APN 15 73130897 missense possibly damaging 0.76
IGL02973:Ago2 APN 15 73123465 splice site probably benign
IGL03188:Ago2 APN 15 73123333 missense probably benign
PIT4791001:Ago2 UTSW 15 73121240 missense possibly damaging 0.72
R0316:Ago2 UTSW 15 73130876 missense probably damaging 0.99
R1382:Ago2 UTSW 15 73127040 missense probably benign 0.35
R1509:Ago2 UTSW 15 73116364 missense probably damaging 1.00
R1802:Ago2 UTSW 15 73121180 missense probably damaging 1.00
R1848:Ago2 UTSW 15 73123965 missense probably benign 0.02
R1930:Ago2 UTSW 15 73119355 missense probably damaging 0.97
R2195:Ago2 UTSW 15 73119469 missense probably benign 0.15
R2219:Ago2 UTSW 15 73146411 missense probably benign
R2350:Ago2 UTSW 15 73119461 missense probably benign 0.01
R2517:Ago2 UTSW 15 73124242 missense possibly damaging 0.76
R4614:Ago2 UTSW 15 73130967 missense probably damaging 0.98
R4667:Ago2 UTSW 15 73146416 missense probably damaging 1.00
R5101:Ago2 UTSW 15 73119490 missense probably damaging 0.99
R5175:Ago2 UTSW 15 73124218 missense possibly damaging 0.57
R5751:Ago2 UTSW 15 73128323 critical splice donor site probably null
R5815:Ago2 UTSW 15 73107366 critical splice acceptor site probably null
R6166:Ago2 UTSW 15 73124240 missense probably benign 0.00
R6378:Ago2 UTSW 15 73123925 missense probably benign
R6572:Ago2 UTSW 15 73126977 missense probably benign 0.14
R6922:Ago2 UTSW 15 73113752 missense probably benign 0.39
R7068:Ago2 UTSW 15 73146450 missense probably damaging 1.00
R7447:Ago2 UTSW 15 73138032 missense probably benign 0.35
R7449:Ago2 UTSW 15 73146499 missense probably damaging 1.00
X0012:Ago2 UTSW 15 73106952 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATCCTGAGACCTGACACCTC -3'
(R):5'- CCATCTTGAGAAGGGAGCTAGC -3'

Sequencing Primer
(F):5'- TGAGACCTGACACCTCCTAAG -3'
(R):5'- CAGTACTATCTGCTGTGAGGGAC -3'
Posted On2015-03-18