Incidental Mutation 'R3727:Gm44501'
ID270850
Institutional Source Beutler Lab
Gene Symbol Gm44501
Ensembl Gene ENSMUSG00000090897
Gene Namepredicted readthrough transcript, 44501
SynonymsEsp6Esp5
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location40561507-40579549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40576615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 8 (F8S)
Ref Sequence ENSEMBL: ENSMUSP00000128205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167713]
Predicted Effect unknown
Transcript: ENSMUST00000167713
AA Change: F8S
SMART Domains Protein: ENSMUSP00000128205
Gene: ENSMUSG00000090897
AA Change: F8S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ESP 24 84 2e-24 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Esp6 (exocrine gland secreted peptide 6) and Esp5 (exocrine gland secreted peptide 5) genes on chromosome 17. The readthrough transcript encodes a protein that shares sequence identity with the downstream gene product, but is shorter at its N-terminus. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Gm44501
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0141:Gm44501 UTSW 17 40578853 missense probably benign 0.01
R2420:Gm44501 UTSW 17 40578709 missense possibly damaging 0.93
R4484:Gm44501 UTSW 17 40576616 missense unknown
R4735:Gm44501 UTSW 17 40578919 missense probably benign 0.00
R4795:Gm44501 UTSW 17 40578714 missense probably benign 0.01
R4888:Gm44501 UTSW 17 40576624 missense unknown
R4904:Gm44501 UTSW 17 40578993 missense possibly damaging 0.46
R5057:Gm44501 UTSW 17 40578672 missense probably benign 0.00
R7429:Gm44501 UTSW 17 40576626 missense probably null
R7746:Gm44501 UTSW 17 40578829 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGCAAGGTTATCAGTCAAGTGC -3'
(R):5'- GCCCTGTTATATGCTCCAAGAC -3'

Sequencing Primer
(F):5'- CAAGGTTATCAGTCAAGTGCTTTAGG -3'
(R):5'- GCTCCAAGACACAAATGAGAATATTG -3'
Posted On2015-03-18