Incidental Mutation 'R3727:Dpp3'
ID270853
Institutional Source Beutler Lab
Gene Symbol Dpp3
Ensembl Gene ENSMUSG00000063904
Gene Namedipeptidylpeptidase 3
Synonyms4930533O14Rik
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4907229-4928287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4923185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 127 (I127T)
Ref Sequence ENSEMBL: ENSMUSP00000025851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851]
Predicted Effect probably benign
Transcript: ENSMUST00000025851
AA Change: I127T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904
AA Change: I127T

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Meta Mutation Damage Score 0.2445 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Dpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Dpp3 APN 19 4913892 missense probably benign 0.00
IGL01657:Dpp3 APN 19 4918304 missense possibly damaging 0.72
IGL02105:Dpp3 APN 19 4916771 missense probably damaging 1.00
IGL02251:Dpp3 APN 19 4918315 missense probably benign
IGL02669:Dpp3 APN 19 4923682 critical splice donor site probably null
IGL02739:Dpp3 APN 19 4923728 missense probably damaging 1.00
IGL02851:Dpp3 APN 19 4923131 missense probably benign 0.06
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0053:Dpp3 UTSW 19 4923126 missense probably damaging 0.99
R0505:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R0681:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R1163:Dpp3 UTSW 19 4914923 nonsense probably null
R1200:Dpp3 UTSW 19 4923129 missense probably benign
R1761:Dpp3 UTSW 19 4921149 missense probably benign 0.37
R1931:Dpp3 UTSW 19 4917860 splice site probably benign
R2255:Dpp3 UTSW 19 4918319 missense probably benign
R2424:Dpp3 UTSW 19 4907707 nonsense probably null
R3718:Dpp3 UTSW 19 4923065 critical splice donor site probably null
R5080:Dpp3 UTSW 19 4915080 missense probably benign 0.00
R5587:Dpp3 UTSW 19 4918267 missense probably damaging 0.98
R5786:Dpp3 UTSW 19 4918322 missense possibly damaging 0.53
R5986:Dpp3 UTSW 19 4918357 missense probably benign 0.18
R6128:Dpp3 UTSW 19 4922392 missense probably benign 0.05
R6989:Dpp3 UTSW 19 4921167 missense probably damaging 1.00
R7019:Dpp3 UTSW 19 4916789 missense possibly damaging 0.83
R7070:Dpp3 UTSW 19 4918328 missense probably benign 0.24
R7100:Dpp3 UTSW 19 4918041 missense probably damaging 1.00
R7265:Dpp3 UTSW 19 4923769 missense probably damaging 1.00
R7495:Dpp3 UTSW 19 4917913 missense probably damaging 1.00
R7916:Dpp3 UTSW 19 4917024 nonsense probably null
Z1176:Dpp3 UTSW 19 4922341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTCAGTTCAAGAGTAGG -3'
(R):5'- GTGGTAGCCTGAGGTTCAAC -3'

Sequencing Primer
(F):5'- AGTAGGGAAGAGCCTCCTGC -3'
(R):5'- GAGGTTCAACTCTTCTCAGGGC -3'
Posted On2015-03-18