Incidental Mutation 'R3729:Slc16a10'
ID270884
Institutional Source Beutler Lab
Gene Symbol Slc16a10
Ensembl Gene ENSMUSG00000019838
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 10
SynonymsMct10, 2610103N14Rik, TAT1, PRO0813
MMRRC Submission 040719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R3729 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location40033532-40142258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40056624 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 314 (H314D)
Ref Sequence ENSEMBL: ENSMUSP00000090227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092566
AA Change: H314D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: H314D

DomainStartEndE-ValueType
Pfam:MFS_1 66 320 1.1e-13 PFAM
Pfam:MFS_4 269 464 4.3e-11 PFAM
Pfam:MFS_1 291 507 4.3e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213827
AA Change: H27D
Meta Mutation Damage Score 0.6759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,207,348 D954G probably damaging Het
Acvr1 T C 2: 58,462,913 K345R probably null Het
Aldoart2 A G 12: 55,566,319 Y343C probably damaging Het
Arpp21 T A 9: 112,065,979 Y739F possibly damaging Het
Cachd1 C A 4: 100,974,880 Y746* probably null Het
Card14 T C 11: 119,333,932 V595A probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Dnah12 T A 14: 26,706,065 D171E probably benign Het
Fat3 A G 9: 16,247,041 probably benign Het
Fmnl3 A G 15: 99,321,864 F668L probably damaging Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Gcn1l1 A T 5: 115,583,394 probably benign Het
Hspbp1 G T 7: 4,677,809 Q223K probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Igkv4-90 A G 6: 68,807,681 F10L probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Kif4-ps A G 12: 101,146,110 E166G probably damaging Het
Lemd3 T C 10: 120,928,015 D780G probably damaging Het
Manba G A 3: 135,554,850 V599I probably benign Het
Map2 A G 1: 66,412,446 E247G possibly damaging Het
Mfsd1 T C 3: 67,582,965 F50L probably benign Het
Mier2 T C 10: 79,545,042 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Olfr486 A T 7: 108,172,309 I145N probably benign Het
Olfr926 T C 9: 38,877,251 F25S probably damaging Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Prrx1 A G 1: 163,261,877 L127P probably damaging Het
Rbsn T C 6: 92,191,335 M373V possibly damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc4a7 A T 14: 14,729,276 E47D probably damaging Het
Taf12 C A 4: 132,282,954 P78Q probably damaging Het
Tnn A G 1: 160,146,240 C186R probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Trip4 T C 9: 65,880,942 N74D possibly damaging Het
Tssk5 C T 15: 76,372,896 R262H probably benign Het
Vegfa T C 17: 46,024,520 I105V possibly damaging Het
Vmn2r14 T C 5: 109,216,229 Y607C probably damaging Het
Wdr83 G T 8: 85,080,339 H66Q probably damaging Het
Zfp280b A G 10: 76,039,102 T272A probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Slc16a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Slc16a10 APN 10 40076925 missense probably damaging 1.00
R0030:Slc16a10 UTSW 10 40076823 missense probably benign 0.04
R0196:Slc16a10 UTSW 10 40056615 missense probably benign 0.01
R0200:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0418:Slc16a10 UTSW 10 40040631 nonsense probably null
R0463:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0599:Slc16a10 UTSW 10 40141918 missense probably benign
R1162:Slc16a10 UTSW 10 40076553 missense probably benign 0.00
R1554:Slc16a10 UTSW 10 40076800 missense probably benign 0.00
R1901:Slc16a10 UTSW 10 40056606 nonsense probably null
R3622:Slc16a10 UTSW 10 40141894 missense probably benign
R3624:Slc16a10 UTSW 10 40141894 missense probably benign
R3717:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3719:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3730:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3731:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3801:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3803:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3804:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4037:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4038:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4254:Slc16a10 UTSW 10 40077001 missense probably damaging 1.00
R4980:Slc16a10 UTSW 10 40080805 missense probably damaging 1.00
R5498:Slc16a10 UTSW 10 40037327 missense probably damaging 0.99
R5542:Slc16a10 UTSW 10 40076788 missense probably benign 0.03
R6541:Slc16a10 UTSW 10 40037272 missense probably benign 0.00
R6555:Slc16a10 UTSW 10 40080778 missense probably benign 0.41
R6998:Slc16a10 UTSW 10 40056503 missense possibly damaging 0.63
R7171:Slc16a10 UTSW 10 40037259 missense probably benign 0.03
R7354:Slc16a10 UTSW 10 40076955 missense probably damaging 1.00
R7414:Slc16a10 UTSW 10 40141996 missense probably benign 0.02
R7728:Slc16a10 UTSW 10 40040758 missense probably damaging 1.00
R7792:Slc16a10 UTSW 10 40037415 splice site probably null
R8366:Slc16a10 UTSW 10 40076871 missense probably benign 0.01
Z1177:Slc16a10 UTSW 10 40076971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCTACAGAAGGAGCAC -3'
(R):5'- GGACTTATCACAGGAGCTGC -3'

Sequencing Primer
(F):5'- ACCCAGAGAGGACCTTCAGG -3'
(R):5'- TCACAGGAGCTGCTTTTAAATG -3'
Posted On2015-03-18