Mutagenetix > Incidental Mutations

Incidental Mutation 'R3729:Zfp280b'

270885

Institutional Source

Beutler Lab

Gene Symbol

Zfp280b

Ensembl Gene

ENSMUSG00000049764

Gene Name

zinc finger protein 280B

Synonyms

Suhw2, D10Jhu82e

MMRRC Submission

040719-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R3729 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76032650-76043234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76039102 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 272 (T272A)

Ref Sequence

ENSEMBL: ENSMUSP00000056340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]

Predicted Effect

probably benign
Transcript: ENSMUST00000061617
AA Change: T272A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: T272A

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	29	37	N/A	INTRINSIC
Pfam:DUF4195	53	227	1.3e-38	PFAM
ZnF_C2H2	297	318	3.65e1	SMART
ZnF_C2H2	334	357	9.46e0	SMART
ZnF_C2H2	364	387	8.22e-2	SMART
ZnF_C2H2	394	417	4.23e0	SMART
ZnF_C2H2	423	445	1.72e1	SMART
ZnF_C2H2	451	474	2.12e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218627

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	G	5: 114,207,348	D954G	probably damaging	Het
Acvr1	T	C	2: 58,462,913	K345R	probably null	Het
Aldoart2	A	G	12: 55,566,319	Y343C	probably damaging	Het
Arpp21	T	A	9: 112,065,979	Y739F	possibly damaging	Het
Cachd1	C	A	4: 100,974,880	Y746*	probably null	Het
Card14	T	C	11: 119,333,932	V595A	probably damaging	Het
Dhx33	T	C	11: 70,989,152	D344G	probably benign	Het
Dnah12	T	A	14: 26,706,065	D171E	probably benign	Het
Fat3	A	G	9: 16,247,041		probably benign	Het
Fmnl3	A	G	15: 99,321,864	F668L	probably damaging	Het
Frmpd4	G	A	X: 167,486,807	T493M	probably damaging	Het
Gcn1l1	A	T	5: 115,583,394		probably benign	Het
Hspbp1	G	T	7: 4,677,809	Q223K	probably damaging	Het
Ighv1-19	C	A	12: 114,708,877	C40F	probably damaging	Het
Igkv4-90	A	G	6: 68,807,681	F10L	probably benign	Het
Kctd5	T	C	17: 24,059,238	D146G	probably benign	Het
Kif4-ps	A	G	12: 101,146,110	E166G	probably damaging	Het
Lemd3	T	C	10: 120,928,015	D780G	probably damaging	Het
Manba	G	A	3: 135,554,850	V599I	probably benign	Het
Map2	A	G	1: 66,412,446	E247G	possibly damaging	Het
Mfsd1	T	C	3: 67,582,965	F50L	probably benign	Het
Mier2	T	C	10: 79,545,042		probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nol10	A	T	12: 17,424,673	K622I	probably benign	Het
Olfr486	A	T	7: 108,172,309	I145N	probably benign	Het
Olfr926	T	C	9: 38,877,251	F25S	probably damaging	Het
Phtf1	A	G	3: 103,985,779	M120V	probably benign	Het
Prrx1	A	G	1: 163,261,877	L127P	probably damaging	Het
Rbsn	T	C	6: 92,191,335	M373V	possibly damaging	Het
Sec24b	T	C	3: 130,033,833	K203R	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc4a7	A	T	14: 14,729,276	E47D	probably damaging	Het
Taf12	C	A	4: 132,282,954	P78Q	probably damaging	Het
Tnn	A	G	1: 160,146,240	C186R	probably damaging	Het
Trim46	T	A	3: 89,234,949	T721S	probably benign	Het
Trip4	T	C	9: 65,880,942	N74D	possibly damaging	Het
Tssk5	C	T	15: 76,372,896	R262H	probably benign	Het
Vegfa	T	C	17: 46,024,520	I105V	possibly damaging	Het
Vmn2r14	T	C	5: 109,216,229	Y607C	probably damaging	Het
Wdr83	G	T	8: 85,080,339	H66Q	probably damaging	Het
Zfp960	T	A	17: 17,088,371	L449H	probably damaging	Het

Other mutations in Zfp280b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01394:Zfp280b	APN	10	76039663	missense	probably damaging	0.99
IGL02016:Zfp280b	APN	10	76039111	missense	possibly damaging	0.68
IGL02245:Zfp280b	APN	10	76039363	missense	probably benign
IGL03233:Zfp280b	APN	10	76039769	missense	probably damaging	1.00
R0864:Zfp280b	UTSW	10	76038305	missense	probably benign	0.00
R1501:Zfp280b	UTSW	10	76039769	missense	probably damaging	1.00
R1643:Zfp280b	UTSW	10	76039610	missense	probably damaging	1.00
R2004:Zfp280b	UTSW	10	76038536	missense	probably benign	0.00
R2024:Zfp280b	UTSW	10	76038494	missense	probably damaging	1.00
R2025:Zfp280b	UTSW	10	76038494	missense	probably damaging	1.00
R2027:Zfp280b	UTSW	10	76038494	missense	probably damaging	1.00
R2064:Zfp280b	UTSW	10	76039183	missense	probably damaging	1.00
R4634:Zfp280b	UTSW	10	76038829	missense	probably benign	0.00
R4812:Zfp280b	UTSW	10	76039090	missense	probably benign	0.24
R4968:Zfp280b	UTSW	10	76039354	missense	probably damaging	1.00
R5007:Zfp280b	UTSW	10	76039214	missense	probably damaging	1.00
R5123:Zfp280b	UTSW	10	76039349	missense	probably benign	0.02
R5503:Zfp280b	UTSW	10	76039462	splice site	probably null
R5552:Zfp280b	UTSW	10	76039663	nonsense	probably null
R6954:Zfp280b	UTSW	10	76039688	missense	probably benign	0.36
R7299:Zfp280b	UTSW	10	76038703	missense	probably damaging	0.98
R7301:Zfp280b	UTSW	10	76038703	missense	probably damaging	0.98
R7485:Zfp280b	UTSW	10	76039241	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAACAGAGGACACCTTCC -3'
(R):5'- AGATTTTGCAGACCACGGAAG -3'

Sequencing Primer
(F):5'- GGACACCTTCCTTTGATGCTC -3'
(R):5'- ATGTGGCACTCCAGCTGGAAC -3'

Posted On

2015-03-18