Incidental Mutation 'R3729:Nol10'
ID270891
Institutional Source Beutler Lab
Gene Symbol Nol10
Ensembl Gene ENSMUSG00000061458
Gene Namenucleolar protein 10
SynonymsLOC217431
MMRRC Submission 040719-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R3729 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17348458-17430095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17424673 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 622 (K622I)
Ref Sequence ENSEMBL: ENSMUSP00000035930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046011]
Predicted Effect probably benign
Transcript: ENSMUST00000046011
AA Change: K622I

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035930
Gene: ENSMUSG00000061458
AA Change: K622I

DomainStartEndE-ValueType
WD40 42 81 1.1e1 SMART
Blast:WD40 84 123 1e-8 BLAST
WD40 165 204 3.3e1 SMART
WD40 223 257 4.42e1 SMART
WD40 260 299 1.19e1 SMART
WD40 302 340 1.97e2 SMART
low complexity region 451 476 N/A INTRINSIC
Pfam:NUC153 482 509 1.4e-15 PFAM
low complexity region 515 536 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
coiled coil region 557 588 N/A INTRINSIC
low complexity region 650 660 N/A INTRINSIC
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,207,348 D954G probably damaging Het
Acvr1 T C 2: 58,462,913 K345R probably null Het
Aldoart2 A G 12: 55,566,319 Y343C probably damaging Het
Arpp21 T A 9: 112,065,979 Y739F possibly damaging Het
Cachd1 C A 4: 100,974,880 Y746* probably null Het
Card14 T C 11: 119,333,932 V595A probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Dnah12 T A 14: 26,706,065 D171E probably benign Het
Fat3 A G 9: 16,247,041 probably benign Het
Fmnl3 A G 15: 99,321,864 F668L probably damaging Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Gcn1l1 A T 5: 115,583,394 probably benign Het
Hspbp1 G T 7: 4,677,809 Q223K probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Igkv4-90 A G 6: 68,807,681 F10L probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Kif4-ps A G 12: 101,146,110 E166G probably damaging Het
Lemd3 T C 10: 120,928,015 D780G probably damaging Het
Manba G A 3: 135,554,850 V599I probably benign Het
Map2 A G 1: 66,412,446 E247G possibly damaging Het
Mfsd1 T C 3: 67,582,965 F50L probably benign Het
Mier2 T C 10: 79,545,042 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfr486 A T 7: 108,172,309 I145N probably benign Het
Olfr926 T C 9: 38,877,251 F25S probably damaging Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Prrx1 A G 1: 163,261,877 L127P probably damaging Het
Rbsn T C 6: 92,191,335 M373V possibly damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc4a7 A T 14: 14,729,276 E47D probably damaging Het
Taf12 C A 4: 132,282,954 P78Q probably damaging Het
Tnn A G 1: 160,146,240 C186R probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Trip4 T C 9: 65,880,942 N74D possibly damaging Het
Tssk5 C T 15: 76,372,896 R262H probably benign Het
Vegfa T C 17: 46,024,520 I105V possibly damaging Het
Vmn2r14 T C 5: 109,216,229 Y607C probably damaging Het
Wdr83 G T 8: 85,080,339 H66Q probably damaging Het
Zfp280b A G 10: 76,039,102 T272A probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Nol10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Nol10 APN 12 17361129 splice site probably benign
R1769:Nol10 UTSW 12 17416708 splice site probably benign
R1884:Nol10 UTSW 12 17368389 critical splice donor site probably null
R1930:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R1931:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R2010:Nol10 UTSW 12 17416101 missense probably benign 0.00
R2037:Nol10 UTSW 12 17361151 missense probably benign 0.01
R2168:Nol10 UTSW 12 17373584 missense probably damaging 1.00
R3731:Nol10 UTSW 12 17424673 missense probably benign 0.42
R4368:Nol10 UTSW 12 17379292 missense probably damaging 1.00
R4618:Nol10 UTSW 12 17348561 missense probably damaging 0.98
R4736:Nol10 UTSW 12 17355287 missense probably damaging 1.00
R5342:Nol10 UTSW 12 17369620 splice site probably null
R5451:Nol10 UTSW 12 17359102 nonsense probably null
R5536:Nol10 UTSW 12 17416137 nonsense probably null
R5586:Nol10 UTSW 12 17416828 missense possibly damaging 0.73
R6045:Nol10 UTSW 12 17348478 start gained probably benign
R6833:Nol10 UTSW 12 17352727 missense probably benign 0.03
R7039:Nol10 UTSW 12 17429184 missense possibly damaging 0.94
R7189:Nol10 UTSW 12 17373561 critical splice acceptor site probably null
R7251:Nol10 UTSW 12 17402107 missense probably damaging 1.00
R7399:Nol10 UTSW 12 17402173 missense probably damaging 1.00
R7600:Nol10 UTSW 12 17369480 missense probably damaging 0.99
R7650:Nol10 UTSW 12 17362682 critical splice donor site probably null
R7729:Nol10 UTSW 12 17424675 missense possibly damaging 0.62
R7772:Nol10 UTSW 12 17348585 missense probably damaging 1.00
R7869:Nol10 UTSW 12 17358238 missense probably null 0.93
R7972:Nol10 UTSW 12 17352647 missense probably benign 0.15
Z1177:Nol10 UTSW 12 17359088 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGACAGTTTGAGGGCAGC -3'
(R):5'- CTCTGGCTATAGGAAACACTGG -3'

Sequencing Primer
(F):5'- ACAGTTTGAGGGCAGCTGACTC -3'
(R):5'- CTGGAGTAGGGAACACAGCTTTCTC -3'
Posted On2015-03-18