Mutagenetix > Incidental Mutation

Incidental Mutation 'R3730:Mroh2a'

270905

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R3730 (G1)

Quality Score

175

Status

Not validated

Chromosome

Chromosomal Location

88154713-88190011 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCC to GC at 88159979 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

AlphaFold

D3Z750

Predicted Effect

probably null
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148474

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.2%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	G	1: 11,615,450 (GRCm39)	N141S	probably damaging	Het
Acbd6	T	A	1: 155,434,471 (GRCm39)	S30T	probably benign	Het
Acot12	T	A	13: 91,908,145 (GRCm39)	F109Y	possibly damaging	Het
Adamts19	G	A	18: 59,033,982 (GRCm39)	R319Q	probably damaging	Het
Akap1	T	C	11: 88,736,008 (GRCm39)	E218G	possibly damaging	Het
Atg4b	T	A	1: 93,695,997 (GRCm39)	D45E	probably damaging	Het
Atoh1	A	G	6: 64,706,557 (GRCm39)	E84G	probably benign	Het
Cemip2	A	G	19: 21,803,481 (GRCm39)	Y838C	probably damaging	Het
Cfap251	A	T	5: 123,464,631 (GRCm39)	I1280L	possibly damaging	Het
Cfap54	A	T	10: 92,847,335 (GRCm39)	Y951*	probably null	Het
Col4a4	T	A	1: 82,433,472 (GRCm39)		probably null	Het
Crlf1	A	G	8: 70,952,092 (GRCm39)	T95A	probably benign	Het
Cyp3a25	G	A	5: 145,939,891 (GRCm39)	P39S	probably damaging	Het
Dhx9	C	A	1: 153,353,866 (GRCm39)	A186S	probably benign	Het
Dusp16	A	G	6: 134,695,824 (GRCm39)	S336P	probably benign	Het
Fcgbp	T	C	7: 27,784,882 (GRCm39)	V314A	possibly damaging	Het
Focad	T	C	4: 88,327,162 (GRCm39)	I157T	possibly damaging	Het
Frem3	A	T	8: 81,342,545 (GRCm39)	T1613S	probably damaging	Het
Fshr	C	T	17: 89,309,143 (GRCm39)	V222I	probably benign	Het
Galnt13	A	G	2: 54,823,519 (GRCm39)	N365S	possibly damaging	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Ice1	A	T	13: 70,751,359 (GRCm39)	S1576T	probably damaging	Het
Ighv1-19	C	A	12: 114,672,497 (GRCm39)	C40F	probably damaging	Het
Itga8	T	C	2: 12,198,321 (GRCm39)	T555A	possibly damaging	Het
Kctd5	T	C	17: 24,278,212 (GRCm39)	D146G	probably benign	Het
Ktn1	A	G	14: 47,938,606 (GRCm39)	E766G	probably damaging	Het
Ldlr	C	G	9: 21,643,097 (GRCm39)	A41G	probably benign	Het
Lrp2	G	A	2: 69,294,923 (GRCm39)	P3465L	probably damaging	Het
Lrp2	A	T	2: 69,365,251 (GRCm39)		probably null	Het
Mapk11	G	A	15: 89,029,318 (GRCm39)	A248V	probably benign	Het
Mslnl	G	A	17: 25,961,908 (GRCm39)	V128M	probably damaging	Het
Npr2	T	C	4: 43,640,999 (GRCm39)	S402P	possibly damaging	Het
Olfm2	T	C	9: 20,584,063 (GRCm39)	N76D	probably damaging	Het
Or7g33	T	A	9: 19,448,447 (GRCm39)	I260F	probably benign	Het
Or8k3	A	G	2: 86,059,195 (GRCm39)	I40T	probably benign	Het
Pias4	A	T	10: 80,999,888 (GRCm39)	F55Y	probably damaging	Het
Rgs12	G	A	5: 35,189,595 (GRCm39)	E658K	probably damaging	Het
Ripor3	C	G	2: 167,834,739 (GRCm39)	E251Q	probably damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Slc16a10	G	C	10: 39,932,620 (GRCm39)	H314D	possibly damaging	Het
Slc35e4	A	G	11: 3,862,577 (GRCm39)	V204A	possibly damaging	Het
Syt4	T	C	18: 31,577,189 (GRCm39)	H55R	probably damaging	Het
Trim46	T	A	3: 89,142,256 (GRCm39)	T721S	probably benign	Het
Usf3	G	T	16: 44,038,938 (GRCm39)	L1139F	probably benign	Het
Xrn2	A	T	2: 146,866,729 (GRCm39)	M100L	probably benign	Het
Zbtb33	C	A	X: 37,281,822 (GRCm39)	N243K	probably benign	Het
Zfp960	T	A	17: 17,308,633 (GRCm39)	L449H	probably damaging	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88,172,692 (GRCm39)	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88,161,842 (GRCm39)	missense	possibly damaging	0.76
IGL00990:Mroh2a	APN	1	88,158,468 (GRCm39)	missense	probably damaging	0.99
IGL03097:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0068:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0139:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0374:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0583:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0613:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0657:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88,156,102 (GRCm39)	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0689:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0735:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0845:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R0960:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1281:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
R1414:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88,169,353 (GRCm39)	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88,160,075 (GRCm39)	splice site	probably benign
R1442:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1686:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1846:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88,165,213 (GRCm39)	nonsense	probably null
R2122:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2870:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2871:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3408:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3608:Mroh2a	UTSW	1	88,172,717 (GRCm39)	missense	probably damaging	1.00
R3937:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88,187,311 (GRCm39)	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88,179,087 (GRCm39)	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88,165,666 (GRCm39)	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5031:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5062:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5301:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5615:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5825:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R5891:Mroh2a	UTSW	1	88,169,337 (GRCm39)	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88,176,377 (GRCm39)	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88,158,390 (GRCm39)	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6074:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6127:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6234:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6244:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6575:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6809:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88,171,805 (GRCm39)	splice site	probably null
R9414:Mroh2a	UTSW	1	88,179,096 (GRCm39)	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88,170,207 (GRCm39)	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88,154,813 (GRCm39)	start gained	probably benign
V8831:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
X0027:Mroh2a	UTSW	1	88,176,335 (GRCm39)	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0028:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0033:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,160,014 (GRCm39)	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0039:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,377 (GRCm39)	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0063:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATATGCCCTTGAGCAGACATG -3'
(R):5'- GCAAAGCAACCACTGGGATG -3'

Sequencing Primer
(F):5'- AGTTCACCCTTTTTAAACATGTGGC -3'
(R):5'- TGGGATGCAAACCAACTTCTCATTC -3'

Posted On

2015-03-18