Incidental Mutation 'R3730:Galnt13'
ID270911
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54933507 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 365 (N365S)
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068595
AA Change: N365S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: N365S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112634
AA Change: N365S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: N365S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112635
AA Change: N365S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: N365S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112636
AA Change: N365S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: N365S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 A T 2: 69,534,907 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8525:Galnt13 UTSW 2 55060476 missense possibly damaging 0.95
R8539:Galnt13 UTSW 2 54933572 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGGTCATGACAAGAATTCTCATTG -3'
(R):5'- ACATTCTGTCTTTTGGGGAAATAAG -3'

Sequencing Primer
(F):5'- CAGATCTGGCAATGTGGA -3'
(R):5'- GAGGATGCAAAAATGTTTCATTGG -3'
Posted On2015-03-18