Incidental Mutation 'R3730:Npr2'
ID270920
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Namenatriuretic peptide receptor 2
Synonymspwe, cn, guanylyl cyclase-B
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.832) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43631935-43651244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43640999 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 402 (S402P)
Ref Sequence ENSEMBL: ENSMUSP00000030191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030191
AA Change: S402P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: S402P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107874
AA Change: S402P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: S402P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123351
SMART Domains Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 71 173 1.3e-12 PFAM
Pfam:Pkinase 85 170 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
palmer UTSW 4 43647553 missense probably damaging 1.00
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 unclassified probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
R8235:Npr2 UTSW 4 43641603 missense probably benign 0.09
Z1176:Npr2 UTSW 4 43650720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAAGGGAAGAGTCACTG -3'
(R):5'- TCTGCTCCAGAGTAATGGGC -3'

Sequencing Primer
(F):5'- TGGACACACGTCACTGTG -3'
(R):5'- TCCAGAGTAATGGGCTGCGG -3'
Posted On2015-03-18