Incidental Mutation 'R3730:Atoh1'
ID270926
Institutional Source Beutler Lab
Gene Symbol Atoh1
Ensembl Gene ENSMUSG00000073043
Gene Nameatonal bHLH transcription factor 1
SynonymsbHLHa14, Hath1, Math1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3730 (G1)
Quality Score180
Status Not validated
Chromosome6
Chromosomal Location64729125-64731245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64729573 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000098903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101351]
Predicted Effect probably benign
Transcript: ENSMUST00000101351
AA Change: E84G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000098903
Gene: ENSMUSG00000073043
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
HLH 162 214 1.1e-20 SMART
low complexity region 243 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the basic helix-loop-helix (BHLH) family of transcription factors. It activates E-box dependent transcription along with E47. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a decreased cerebellum without folia, and lack cerebellar granule neurons, inner-ear hair cells, D1 interneurons, and goblet, enteroendocrine, and Paneth cells. Mutants fail to breathe properly and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Atoh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Atoh1 APN 6 64729584 missense possibly damaging 0.54
IGL02126:Atoh1 APN 6 64729350 missense probably damaging 1.00
R1354:Atoh1 UTSW 6 64729357 missense possibly damaging 0.53
R1674:Atoh1 UTSW 6 64729930 missense possibly damaging 0.88
R1675:Atoh1 UTSW 6 64730157 missense probably benign 0.01
R1895:Atoh1 UTSW 6 64729459 missense probably benign 0.01
R1946:Atoh1 UTSW 6 64729459 missense probably benign 0.01
R1988:Atoh1 UTSW 6 64729633 missense probably benign 0.04
R2566:Atoh1 UTSW 6 64729684 missense probably damaging 1.00
R3893:Atoh1 UTSW 6 64730133 missense probably damaging 1.00
R4241:Atoh1 UTSW 6 64729774 missense probably damaging 1.00
R7411:Atoh1 UTSW 6 64729930 missense probably damaging 1.00
R7749:Atoh1 UTSW 6 64729920 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCCATTGCAGTGCGATGTC -3'
(R):5'- CATTCACCTGTTTGCTGGAAGG -3'

Sequencing Primer
(F):5'- CTGCATGCAGAAGAGTGGGC -3'
(R):5'- TTGCTGGAAGGGGCTCGC -3'
Posted On2015-03-18