Incidental Mutation 'R3730:Atoh1'
ID 270926
Institutional Source Beutler Lab
Gene Symbol Atoh1
Ensembl Gene ENSMUSG00000073043
Gene Name atonal bHLH transcription factor 1
Synonyms Math1, bHLHa14, Hath1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3730 (G1)
Quality Score 180
Status Not validated
Chromosome 6
Chromosomal Location 64706109-64708229 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64706557 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000098903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101351]
AlphaFold P48985
Predicted Effect probably benign
Transcript: ENSMUST00000101351
AA Change: E84G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000098903
Gene: ENSMUSG00000073043
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
HLH 162 214 1.1e-20 SMART
low complexity region 243 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the basic helix-loop-helix (BHLH) family of transcription factors. It activates E-box dependent transcription along with E47. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a decreased cerebellum without folia, and lack cerebellar granule neurons, inner-ear hair cells, D1 interneurons, and goblet, enteroendocrine, and Paneth cells. Mutants fail to breathe properly and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,615,450 (GRCm39) N141S probably damaging Het
Acbd6 T A 1: 155,434,471 (GRCm39) S30T probably benign Het
Acot12 T A 13: 91,908,145 (GRCm39) F109Y possibly damaging Het
Adamts19 G A 18: 59,033,982 (GRCm39) R319Q probably damaging Het
Akap1 T C 11: 88,736,008 (GRCm39) E218G possibly damaging Het
Atg4b T A 1: 93,695,997 (GRCm39) D45E probably damaging Het
Cemip2 A G 19: 21,803,481 (GRCm39) Y838C probably damaging Het
Cfap251 A T 5: 123,464,631 (GRCm39) I1280L possibly damaging Het
Cfap54 A T 10: 92,847,335 (GRCm39) Y951* probably null Het
Col4a4 T A 1: 82,433,472 (GRCm39) probably null Het
Crlf1 A G 8: 70,952,092 (GRCm39) T95A probably benign Het
Cyp3a25 G A 5: 145,939,891 (GRCm39) P39S probably damaging Het
Dhx9 C A 1: 153,353,866 (GRCm39) A186S probably benign Het
Dusp16 A G 6: 134,695,824 (GRCm39) S336P probably benign Het
Fcgbp T C 7: 27,784,882 (GRCm39) V314A possibly damaging Het
Focad T C 4: 88,327,162 (GRCm39) I157T possibly damaging Het
Frem3 A T 8: 81,342,545 (GRCm39) T1613S probably damaging Het
Fshr C T 17: 89,309,143 (GRCm39) V222I probably benign Het
Galnt13 A G 2: 54,823,519 (GRCm39) N365S possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ice1 A T 13: 70,751,359 (GRCm39) S1576T probably damaging Het
Ighv1-19 C A 12: 114,672,497 (GRCm39) C40F probably damaging Het
Itga8 T C 2: 12,198,321 (GRCm39) T555A possibly damaging Het
Kctd5 T C 17: 24,278,212 (GRCm39) D146G probably benign Het
Ktn1 A G 14: 47,938,606 (GRCm39) E766G probably damaging Het
Ldlr C G 9: 21,643,097 (GRCm39) A41G probably benign Het
Lrp2 G A 2: 69,294,923 (GRCm39) P3465L probably damaging Het
Lrp2 A T 2: 69,365,251 (GRCm39) probably null Het
Mapk11 G A 15: 89,029,318 (GRCm39) A248V probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Npr2 T C 4: 43,640,999 (GRCm39) S402P possibly damaging Het
Olfm2 T C 9: 20,584,063 (GRCm39) N76D probably damaging Het
Or7g33 T A 9: 19,448,447 (GRCm39) I260F probably benign Het
Or8k3 A G 2: 86,059,195 (GRCm39) I40T probably benign Het
Pias4 A T 10: 80,999,888 (GRCm39) F55Y probably damaging Het
Rgs12 G A 5: 35,189,595 (GRCm39) E658K probably damaging Het
Ripor3 C G 2: 167,834,739 (GRCm39) E251Q probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc16a10 G C 10: 39,932,620 (GRCm39) H314D possibly damaging Het
Slc35e4 A G 11: 3,862,577 (GRCm39) V204A possibly damaging Het
Syt4 T C 18: 31,577,189 (GRCm39) H55R probably damaging Het
Trim46 T A 3: 89,142,256 (GRCm39) T721S probably benign Het
Usf3 G T 16: 44,038,938 (GRCm39) L1139F probably benign Het
Xrn2 A T 2: 146,866,729 (GRCm39) M100L probably benign Het
Zbtb33 C A X: 37,281,822 (GRCm39) N243K probably benign Het
Zfp960 T A 17: 17,308,633 (GRCm39) L449H probably damaging Het
Other mutations in Atoh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Atoh1 APN 6 64,706,568 (GRCm39) missense possibly damaging 0.54
IGL02126:Atoh1 APN 6 64,706,334 (GRCm39) missense probably damaging 1.00
R1354:Atoh1 UTSW 6 64,706,341 (GRCm39) missense possibly damaging 0.53
R1674:Atoh1 UTSW 6 64,706,914 (GRCm39) missense possibly damaging 0.88
R1675:Atoh1 UTSW 6 64,707,141 (GRCm39) missense probably benign 0.01
R1895:Atoh1 UTSW 6 64,706,443 (GRCm39) missense probably benign 0.01
R1946:Atoh1 UTSW 6 64,706,443 (GRCm39) missense probably benign 0.01
R1988:Atoh1 UTSW 6 64,706,617 (GRCm39) missense probably benign 0.04
R2566:Atoh1 UTSW 6 64,706,668 (GRCm39) missense probably damaging 1.00
R3893:Atoh1 UTSW 6 64,707,117 (GRCm39) missense probably damaging 1.00
R4241:Atoh1 UTSW 6 64,706,758 (GRCm39) missense probably damaging 1.00
R7411:Atoh1 UTSW 6 64,706,914 (GRCm39) missense probably damaging 1.00
R7749:Atoh1 UTSW 6 64,706,904 (GRCm39) missense possibly damaging 0.89
R8196:Atoh1 UTSW 6 64,707,226 (GRCm39) missense probably benign 0.00
R8289:Atoh1 UTSW 6 64,706,893 (GRCm39) missense probably damaging 1.00
R8410:Atoh1 UTSW 6 64,706,634 (GRCm39) missense probably benign
R8444:Atoh1 UTSW 6 64,706,641 (GRCm39) missense probably benign 0.13
R8744:Atoh1 UTSW 6 64,706,902 (GRCm39) missense probably damaging 0.97
R8854:Atoh1 UTSW 6 64,706,189 (GRCm39) start gained probably benign
R8918:Atoh1 UTSW 6 64,707,241 (GRCm39) missense probably damaging 1.00
R9206:Atoh1 UTSW 6 64,706,713 (GRCm39) missense probably benign 0.13
Z1191:Atoh1 UTSW 6 64,706,364 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCCATTGCAGTGCGATGTC -3'
(R):5'- CATTCACCTGTTTGCTGGAAGG -3'

Sequencing Primer
(F):5'- CTGCATGCAGAAGAGTGGGC -3'
(R):5'- TTGCTGGAAGGGGCTCGC -3'
Posted On 2015-03-18