Incidental Mutation 'R3730:Crlf1'
ID270931
Institutional Source Beutler Lab
Gene Symbol Crlf1
Ensembl Gene ENSMUSG00000007888
Gene Namecytokine receptor-like factor 1
SynonymsCLF-1, cytokine receptor like molecule 3, CRLM3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70493158-70504081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70499442 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000119545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000132648] [ENSMUST00000136913]
Predicted Effect probably benign
Transcript: ENSMUST00000008032
AA Change: T217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888
AA Change: T217A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127983
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132648
AA Change: T95A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119545
Gene: ENSMUSG00000007888
AA Change: T95A

DomainStartEndE-ValueType
FN3 16 101 2.11e0 SMART
low complexity region 104 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135773
Predicted Effect probably benign
Transcript: ENSMUST00000136913
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143598
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cytokine type I receptor family. The encoded protein functions as a cytokine receptor subunit and may be involved in immune system regulation and fetal development. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation fail to suckle effectively and do not survive beyond 24 hrs after birth. Newborns exhibit reduced numbers of hematopoietic progenitor cells as well as a significant reduction in the number of motoneurons in the lumbar spinal cord and facial nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Crlf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Crlf1 APN 8 70503640 critical splice donor site probably null
R0317:Crlf1 UTSW 8 70498599 missense probably benign
R0398:Crlf1 UTSW 8 70499089 splice site probably benign
R0437:Crlf1 UTSW 8 70499514 splice site probably null
R1191:Crlf1 UTSW 8 70498828 missense probably damaging 1.00
R1741:Crlf1 UTSW 8 70500906 missense probably damaging 0.99
R3731:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R4467:Crlf1 UTSW 8 70500956 nonsense probably null
R5557:Crlf1 UTSW 8 70498667 missense probably benign 0.12
R6009:Crlf1 UTSW 8 70503479 missense probably damaging 1.00
R6348:Crlf1 UTSW 8 70493340 missense probably benign
R6606:Crlf1 UTSW 8 70501174 missense probably damaging 1.00
R7947:Crlf1 UTSW 8 70499212 missense probably damaging 1.00
X0062:Crlf1 UTSW 8 70498837 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTGAGGTTGGTACCCAG -3'
(R):5'- TATGAACAACCACTGTCCTGC -3'

Sequencing Primer
(F):5'- GTGTGACTTCTGGCAATACTTAC -3'
(R):5'- ACTGTCCTGCAACCACCGTG -3'
Posted On2015-03-18