Incidental Mutation 'R3730:Ldlr'
ID270935
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Namelow density lipoprotein receptor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21723483-21749919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21731801 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 41 (A41G)
Ref Sequence ENSEMBL: ENSMUSP00000034713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
Predicted Effect probably benign
Transcript: ENSMUST00000034713
AA Change: A41G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: A41G

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213114
AA Change: A41G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217613
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21735361 critical splice donor site probably null
IGL01975:Ldlr APN 9 21733697 missense probably benign 0.05
IGL02043:Ldlr APN 9 21733499 missense probably benign 0.03
IGL02524:Ldlr APN 9 21733681 missense probably damaging 1.00
IGL03049:Ldlr APN 9 21745819 missense probably benign 0.00
IGL03113:Ldlr APN 9 21739828 missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21737999 splice site probably benign
R0586:Ldlr UTSW 9 21739744 missense probably benign 0.00
R1398:Ldlr UTSW 9 21739542 missense probably benign 0.01
R1587:Ldlr UTSW 9 21737913 missense probably damaging 0.99
R2198:Ldlr UTSW 9 21732402 missense probably damaging 1.00
R4422:Ldlr UTSW 9 21737952 missense probably damaging 1.00
R5044:Ldlr UTSW 9 21735242 missense probably benign 0.00
R5046:Ldlr UTSW 9 21745907 critical splice donor site probably null
R6186:Ldlr UTSW 9 21723759 start gained probably benign
R6195:Ldlr UTSW 9 21731781 nonsense probably null
R6523:Ldlr UTSW 9 21737253 missense probably damaging 1.00
R6682:Ldlr UTSW 9 21732375 missense probably benign
R7256:Ldlr UTSW 9 21745744 missense probably benign 0.01
R7384:Ldlr UTSW 9 21739794 missense probably benign 0.07
R7823:Ldlr UTSW 9 21742306 critical splice donor site probably null
R8065:Ldlr UTSW 9 21737945 missense probably damaging 1.00
X0024:Ldlr UTSW 9 21739818 missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21739830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACGTCTGACAGGTTGCC -3'
(R):5'- GCCTTCTTCTAACTCACGAATGG -3'

Sequencing Primer
(F):5'- AGGTTGCCCTGGCTATGC -3'
(R):5'- GCAGTAGAGCCCCTTGTCTAGTAAC -3'
Posted On2015-03-18