Incidental Mutation 'R3730:Pias4'
ID270937
Institutional Source Beutler Lab
Gene Symbol Pias4
Ensembl Gene ENSMUSG00000004934
Gene Nameprotein inhibitor of activated STAT 4
SynonymsPIASy
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location81153266-81167923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81164054 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 55 (F55Y)
Ref Sequence ENSEMBL: ENSMUSP00000005064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005064]
Predicted Effect probably damaging
Transcript: ENSMUST00000005064
AA Change: F55Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005064
Gene: ENSMUSG00000004934
AA Change: F55Y

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 123 270 9.6e-35 PFAM
Pfam:zf-MIZ 315 364 2.4e-24 PFAM
low complexity region 429 454 N/A INTRINSIC
low complexity region 469 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129549
Predicted Effect probably damaging
Transcript: ENSMUST00000146764
AA Change: F55Y

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122183
Gene: ENSMUSG00000004934
AA Change: F55Y

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 119 270 1.8e-43 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants display mild postnatal lethality or a normal phenotype depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Pias4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Pias4 APN 10 81155658 missense probably benign 0.07
IGL01790:Pias4 APN 10 81157498 missense probably damaging 0.98
IGL02553:Pias4 APN 10 81163787 missense probably damaging 1.00
IGL02670:Pias4 APN 10 81164070 missense probably damaging 0.99
petrified_forest UTSW 10 81155855 missense probably damaging 1.00
R0083:Pias4 UTSW 10 81164166 missense probably damaging 1.00
R0122:Pias4 UTSW 10 81157087 missense probably damaging 0.96
R0711:Pias4 UTSW 10 81157530 unclassified probably benign
R1399:Pias4 UTSW 10 81155675 missense probably damaging 1.00
R1726:Pias4 UTSW 10 81155855 missense probably damaging 1.00
R1907:Pias4 UTSW 10 81154363 missense possibly damaging 0.46
R4764:Pias4 UTSW 10 81164034 missense possibly damaging 0.88
R4790:Pias4 UTSW 10 81157492 missense probably damaging 0.98
R4808:Pias4 UTSW 10 81155840 unclassified probably null
R6351:Pias4 UTSW 10 81157264 missense probably damaging 1.00
R6786:Pias4 UTSW 10 81157246 missense probably damaging 1.00
R7113:Pias4 UTSW 10 81154453 missense possibly damaging 0.94
R7260:Pias4 UTSW 10 81157468 missense possibly damaging 0.95
R7487:Pias4 UTSW 10 81163972 missense probably benign
R7609:Pias4 UTSW 10 81158026 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCCCAGTCCATTCAAGTAC -3'
(R):5'- CAGCACTCATAGGAAGCAGG -3'

Sequencing Primer
(F):5'- AGTCCATTCAAGTACTTCCCG -3'
(R):5'- GATTAGAGGATCACACCCCTGAG -3'
Posted On2015-03-18