Incidental Mutation 'R3730:Slc35e4'
ID270939
Institutional Source Beutler Lab
Gene Symbol Slc35e4
Ensembl Gene ENSMUSG00000048807
Gene Namesolute carrier family 35, member E4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3730 (G1)
Quality Score174
Status Not validated
Chromosome11
Chromosomal Location3907021-3914664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3912577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000050978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020710] [ENSMUST00000051207] [ENSMUST00000109988] [ENSMUST00000109989] [ENSMUST00000109990] [ENSMUST00000109991] [ENSMUST00000109992] [ENSMUST00000109993] [ENSMUST00000109995]
Predicted Effect probably benign
Transcript: ENSMUST00000020710
SMART Domains Protein: ENSMUSP00000020710
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051207
AA Change: V204A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050978
Gene: ENSMUSG00000048807
AA Change: V204A

DomainStartEndE-ValueType
Pfam:EamA 50 179 1.9e-9 PFAM
Pfam:UAA 68 332 2.1e-15 PFAM
Pfam:TPT 188 327 2.5e-19 PFAM
Pfam:EamA 200 326 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109988
SMART Domains Protein: ENSMUSP00000105615
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109989
SMART Domains Protein: ENSMUSP00000105616
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109990
SMART Domains Protein: ENSMUSP00000105617
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109991
SMART Domains Protein: ENSMUSP00000105618
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 3 331 1.2e-118 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 429 9.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109992
SMART Domains Protein: ENSMUSP00000105619
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109993
SMART Domains Protein: ENSMUSP00000105620
Gene: ENSMUSG00000020432

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109995
AA Change: V204A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105622
Gene: ENSMUSG00000048807
AA Change: V204A

DomainStartEndE-ValueType
Pfam:EamA 47 179 9.7e-7 PFAM
Pfam:TPT 47 327 6.1e-21 PFAM
Pfam:UAA 56 330 1.3e-7 PFAM
Pfam:EamA 187 327 2.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Slc35e4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02350:Slc35e4 APN 11 3912640 missense probably benign 0.00
IGL02357:Slc35e4 APN 11 3912640 missense probably benign 0.00
IGL02631:Slc35e4 APN 11 3907729 missense probably damaging 0.99
R2213:Slc35e4 UTSW 11 3913159 missense possibly damaging 0.62
R2862:Slc35e4 UTSW 11 3912796 missense probably damaging 1.00
R3948:Slc35e4 UTSW 11 3912970 missense probably damaging 1.00
R4650:Slc35e4 UTSW 11 3912677 missense probably damaging 1.00
R4818:Slc35e4 UTSW 11 3912889 missense probably benign 0.01
R5195:Slc35e4 UTSW 11 3912872 missense possibly damaging 0.57
R6488:Slc35e4 UTSW 11 3912602 missense possibly damaging 0.93
R7094:Slc35e4 UTSW 11 3913118 missense probably benign
R7259:Slc35e4 UTSW 11 3912530 intron probably null
R7316:Slc35e4 UTSW 11 3912584 missense probably damaging 1.00
RF005:Slc35e4 UTSW 11 3907960 missense possibly damaging 0.88
RF024:Slc35e4 UTSW 11 3907960 missense possibly damaging 0.88
Z1176:Slc35e4 UTSW 11 3913156 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CTTCAACGAGAGGCAGTAGG -3'
(R):5'- GTTCACAATGGCCTTGTCTG -3'

Sequencing Primer
(F):5'- TGCGGTGGAACAAAAGGATTCTC -3'
(R):5'- ACAATGGCCTTGTCTGCGTTG -3'
Posted On2015-03-18