Mutagenetix > Incidental Mutation

Incidental Mutation 'R3730:Ice1'

270942

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

Accession Numbers

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R3730 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70603240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1576 (S1576T)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

probably damaging
Transcript: ENSMUST00000043493
AA Change: S1576T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S1576T

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.2%
20x: 90.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	G	1: 11,545,226	N141S	probably damaging	Het
Acbd6	T	A	1: 155,558,725	S30T	probably benign	Het
Acot12	T	A	13: 91,760,026	F109Y	possibly damaging	Het
Adamts19	G	A	18: 58,900,910	R319Q	probably damaging	Het
Akap1	T	C	11: 88,845,182	E218G	possibly damaging	Het
Atg4b	T	A	1: 93,768,275	D45E	probably damaging	Het
Atoh1	A	G	6: 64,729,573	E84G	probably benign	Het
Cfap54	A	T	10: 93,011,473	Y951*	probably null	Het
Col4a4	T	A	1: 82,455,751		probably null	Het
Crlf1	A	G	8: 70,499,442	T95A	probably benign	Het
Cyp3a25	G	A	5: 146,003,081	P39S	probably damaging	Het
Dhx9	C	A	1: 153,478,120	A186S	probably benign	Het
Dusp16	A	G	6: 134,718,861	S336P	probably benign	Het
Fcgbp	T	C	7: 28,085,457	V314A	possibly damaging	Het
Focad	T	C	4: 88,408,925	I157T	possibly damaging	Het
Frem3	A	T	8: 80,615,916	T1613S	probably damaging	Het
Fshr	C	T	17: 89,001,715	V222I	probably benign	Het
Galnt13	A	G	2: 54,933,507	N365S	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ighv1-19	C	A	12: 114,708,877	C40F	probably damaging	Het
Itga8	T	C	2: 12,193,510	T555A	possibly damaging	Het
Kctd5	T	C	17: 24,059,238	D146G	probably benign	Het
Ktn1	A	G	14: 47,701,149	E766G	probably damaging	Het
Ldlr	C	G	9: 21,731,801	A41G	probably benign	Het
Lrp2	A	T	2: 69,534,907		probably null	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Mapk11	G	A	15: 89,145,115	A248V	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Npr2	T	C	4: 43,640,999	S402P	possibly damaging	Het
Olfm2	T	C	9: 20,672,767	N76D	probably damaging	Het
Olfr1047	A	G	2: 86,228,851	I40T	probably benign	Het
Olfr853	T	A	9: 19,537,151	I260F	probably benign	Het
Pias4	A	T	10: 81,164,054	F55Y	probably damaging	Het
Rgs12	G	A	5: 35,032,251	E658K	probably damaging	Het
Ripor3	C	G	2: 167,992,819	E251Q	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc35e4	A	G	11: 3,912,577	V204A	possibly damaging	Het
Syt4	T	C	18: 31,444,136	H55R	probably damaging	Het
Tmem2	A	G	19: 21,826,117	Y838C	probably damaging	Het
Trim46	T	A	3: 89,234,949	T721S	probably benign	Het
Usf3	G	T	16: 44,218,575	L1139F	probably benign	Het
Wdr66	A	T	5: 123,326,568	I1280L	possibly damaging	Het
Xrn2	A	T	2: 147,024,809	M100L	probably benign	Het
Zbtb33	C	A	X: 38,192,945	N243K	probably benign	Het
Zfp960	T	A	17: 17,088,371	L449H	probably damaging	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
R9452:Ice1	UTSW	13	70596343	missense	probably damaging	1.00
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACACTATCCTTCCACTAGC -3'
(R):5'- GCCTCGATCAAAGATTTCCAAC -3'

Sequencing Primer
(F):5'- AGTTCCTCAGGCCATGGAGAC -3'
(R):5'- TCGATCAAAGATTTCCAACAAAGATC -3'

Posted On

2015-03-18