Incidental Mutation 'R3730:Ice1'
ID270942
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70603240 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1576 (S1576T)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: S1576T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: S1576T

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mapk11 G A 15: 89,145,115 A248V probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACTATCCTTCCACTAGC -3'
(R):5'- GCCTCGATCAAAGATTTCCAAC -3'

Sequencing Primer
(F):5'- AGTTCCTCAGGCCATGGAGAC -3'
(R):5'- TCGATCAAAGATTTCCAACAAAGATC -3'
Posted On2015-03-18