Incidental Mutation 'R3730:Mapk11'
ID270946
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3730 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89145115 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 248 (A248V)
Ref Sequence ENSEMBL: ENSMUSP00000086204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823] [ENSMUST00000088827]
Predicted Effect probably benign
Transcript: ENSMUST00000088823
AA Change: A248V

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137
AA Change: A248V

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,545,226 N141S probably damaging Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Acot12 T A 13: 91,760,026 F109Y possibly damaging Het
Adamts19 G A 18: 58,900,910 R319Q probably damaging Het
Akap1 T C 11: 88,845,182 E218G possibly damaging Het
Atg4b T A 1: 93,768,275 D45E probably damaging Het
Atoh1 A G 6: 64,729,573 E84G probably benign Het
Cfap54 A T 10: 93,011,473 Y951* probably null Het
Col4a4 T A 1: 82,455,751 probably null Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Cyp3a25 G A 5: 146,003,081 P39S probably damaging Het
Dhx9 C A 1: 153,478,120 A186S probably benign Het
Dusp16 A G 6: 134,718,861 S336P probably benign Het
Fcgbp T C 7: 28,085,457 V314A possibly damaging Het
Focad T C 4: 88,408,925 I157T possibly damaging Het
Frem3 A T 8: 80,615,916 T1613S probably damaging Het
Fshr C T 17: 89,001,715 V222I probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 A T 13: 70,603,240 S1576T probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Itga8 T C 2: 12,193,510 T555A possibly damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Ktn1 A G 14: 47,701,149 E766G probably damaging Het
Ldlr C G 9: 21,731,801 A41G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Npr2 T C 4: 43,640,999 S402P possibly damaging Het
Olfm2 T C 9: 20,672,767 N76D probably damaging Het
Olfr1047 A G 2: 86,228,851 I40T probably benign Het
Olfr853 T A 9: 19,537,151 I260F probably benign Het
Pias4 A T 10: 81,164,054 F55Y probably damaging Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc35e4 A G 11: 3,912,577 V204A possibly damaging Het
Syt4 T C 18: 31,444,136 H55R probably damaging Het
Tmem2 A G 19: 21,826,117 Y838C probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Usf3 G T 16: 44,218,575 L1139F probably benign Het
Wdr66 A T 5: 123,326,568 I1280L possibly damaging Het
Xrn2 A T 2: 147,024,809 M100L probably benign Het
Zbtb33 C A X: 38,192,945 N243K probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
E0370:Mapk11 UTSW 15 89146513 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R2158:Mapk11 UTSW 15 89146372 missense probably damaging 0.98
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3150:Mapk11 UTSW 15 89145450 unclassified probably null
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4424:Mapk11 UTSW 15 89145373 critical splice donor site probably null
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5422:Mapk11 UTSW 15 89146285 missense probably damaging 1.00
R5511:Mapk11 UTSW 15 89145177 critical splice acceptor site probably null
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTCAGCACTGTCTCTG -3'
(R):5'- TGCCCTATGCCATATCACAC -3'

Sequencing Primer
(F):5'- TACCTGAAATGGCCTCCTGG -3'
(R):5'- TATCACACATTACACGGGGCTC -3'
Posted On2015-03-18