Incidental Mutation 'R3731:Ripor3'
ID270968
Institutional Source Beutler Lab
Gene Symbol Ripor3
Ensembl Gene ENSMUSG00000074577
Gene NameRIPOR family member 3
Synonyms2310033K02Rik, Fam65c
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location167980164-168010618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 167992819 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 251 (E251Q)
Ref Sequence ENSEMBL: ENSMUSP00000096672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099073]
Predicted Effect probably damaging
Transcript: ENSMUST00000099073
AA Change: E251Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096672
Gene: ENSMUSG00000074577
AA Change: E251Q

DomainStartEndE-ValueType
Pfam:PL48 19 363 3.5e-169 PFAM
low complexity region 414 423 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
SCOP:d1gw5a_ 794 909 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Ripor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Ripor3 APN 2 167993575 missense probably benign 0.05
IGL01621:Ripor3 APN 2 167997252 missense probably damaging 0.97
IGL01819:Ripor3 APN 2 167980843 missense probably damaging 0.99
IGL01891:Ripor3 APN 2 167983151 missense possibly damaging 0.95
IGL02110:Ripor3 APN 2 167994706 missense possibly damaging 0.95
IGL02270:Ripor3 APN 2 167993496 missense probably damaging 0.97
IGL02403:Ripor3 APN 2 167989330 missense probably damaging 1.00
IGL02445:Ripor3 APN 2 167992762 splice site probably benign
IGL02447:Ripor3 APN 2 167992830 missense probably damaging 0.99
IGL02711:Ripor3 APN 2 168006280 utr 5 prime probably benign
IGL03187:Ripor3 APN 2 167985668 missense possibly damaging 0.64
IGL03304:Ripor3 APN 2 167980928 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0387:Ripor3 UTSW 2 167983772 nonsense probably null
R1457:Ripor3 UTSW 2 167992653 missense probably damaging 1.00
R1481:Ripor3 UTSW 2 168000377 missense possibly damaging 0.95
R1619:Ripor3 UTSW 2 167980845 missense probably damaging 0.96
R2358:Ripor3 UTSW 2 167983865 splice site probably benign
R2431:Ripor3 UTSW 2 167989795 missense probably benign 0.06
R2943:Ripor3 UTSW 2 167983761 missense possibly damaging 0.46
R3000:Ripor3 UTSW 2 167991180 missense probably damaging 1.00
R3730:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R4084:Ripor3 UTSW 2 167984466 missense possibly damaging 0.55
R4796:Ripor3 UTSW 2 167981340 missense probably damaging 0.97
R4854:Ripor3 UTSW 2 167992813 missense probably benign 0.05
R4934:Ripor3 UTSW 2 167982816 missense probably benign
R4968:Ripor3 UTSW 2 167985117 missense probably benign 0.41
R5662:Ripor3 UTSW 2 167993556 missense probably benign 0.01
R5739:Ripor3 UTSW 2 167981283 missense probably damaging 1.00
R5888:Ripor3 UTSW 2 167997287 missense probably damaging 1.00
R6844:Ripor3 UTSW 2 167993333 splice site probably null
R6969:Ripor3 UTSW 2 167985737 missense probably benign 0.01
R6994:Ripor3 UTSW 2 167997266 missense probably damaging 0.99
R7609:Ripor3 UTSW 2 167984570 missense possibly damaging 0.86
R7818:Ripor3 UTSW 2 167989426 missense probably benign 0.09
R8329:Ripor3 UTSW 2 167983199 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGAAGAAGTCTGCGACGTCAC -3'
(R):5'- CAGTATGAGGTACAGCCAGG -3'

Sequencing Primer
(F):5'- AGAAGTCTGCGACGTCACATGTC -3'
(R):5'- AGGTCCTGGGAGGTCTAGGAC -3'
Posted On2015-03-18