Incidental Mutation 'R3731:Sec24b'
ID270974
Institutional Source Beutler Lab
Gene Symbol Sec24b
Ensembl Gene ENSMUSG00000001052
Gene NameSec24 related gene family, member B (S. cerevisiae)
SynonymsSEC24
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129982759-130061553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130033833 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 203 (K203R)
Ref Sequence ENSEMBL: ENSMUSP00000126923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001079] [ENSMUST00000165873] [ENSMUST00000168644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001079
AA Change: K339R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001079
Gene: ENSMUSG00000001052
AA Change: K339R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
low complexity region 229 254 N/A INTRINSIC
low complexity region 316 333 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 363 373 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
low complexity region 450 473 N/A INTRINSIC
low complexity region 486 505 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 585 622 4.1e-17 PFAM
Pfam:Sec23_trunk 658 897 2.4e-87 PFAM
Pfam:Sec23_BS 902 986 3.4e-23 PFAM
Pfam:Sec23_helical 999 1099 8.7e-31 PFAM
Pfam:Gelsolin 1122 1197 4.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165873
AA Change: K111R

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132861
Gene: ENSMUSG00000001052
AA Change: K111R

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 115 123 N/A INTRINSIC
low complexity region 156 181 N/A INTRINSIC
low complexity region 187 210 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 321 359 2.5e-18 PFAM
Pfam:Sec23_trunk 395 634 1.6e-87 PFAM
Pfam:Sec23_BS 639 723 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165889
Predicted Effect possibly damaging
Transcript: ENSMUST00000168644
AA Change: K203R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126923
Gene: ENSMUSG00000001052
AA Change: K203R

DomainStartEndE-ValueType
low complexity region 93 118 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 249 257 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 321 344 N/A INTRINSIC
low complexity region 357 376 N/A INTRINSIC
PDB:3EH1|A 377 411 1e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168908
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein is thought to be a cargo-binding component of the COPII vesicle, and is thought to be involved in the transport of secretory proteins from the endoplasmic reticulum to the Golgi apparatus. Mutations in this gene have been associated with neural tube defects, and are thought to be a result of a disruption in interactions with the protein encoded by the VANGL planar cell polarity protein 2 (VANGL2) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit craniorachischisis, abnormal embryo shape, omphalocele, disoriented hair cells, and failure of eyelid fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Sec24b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Sec24b APN 3 130020646 intron probably benign
IGL01137:Sec24b APN 3 130007444 missense probably benign 0.02
IGL01370:Sec24b APN 3 130007604 splice site probably benign
IGL01931:Sec24b APN 3 130009799 missense probably benign 0.00
PIT4696001:Sec24b UTSW 3 129994391 missense probably benign 0.01
R0193:Sec24b UTSW 3 129988984 missense probably null
R0194:Sec24b UTSW 3 129984165 critical splice donor site probably null
R0403:Sec24b UTSW 3 129989676 missense possibly damaging 0.81
R0403:Sec24b UTSW 3 129999534 missense probably damaging 1.00
R0576:Sec24b UTSW 3 130041336 missense probably benign 0.11
R0583:Sec24b UTSW 3 130041311 nonsense probably null
R0963:Sec24b UTSW 3 130040905 missense probably benign 0.02
R0967:Sec24b UTSW 3 129996782 missense probably damaging 1.00
R1344:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1418:Sec24b UTSW 3 130007423 missense probably damaging 1.00
R1594:Sec24b UTSW 3 129991351 missense probably benign 0.00
R1716:Sec24b UTSW 3 130041016 missense possibly damaging 0.89
R1938:Sec24b UTSW 3 129991361 missense possibly damaging 0.82
R2020:Sec24b UTSW 3 129987728 missense probably damaging 1.00
R2407:Sec24b UTSW 3 130002316 missense probably benign 0.02
R2415:Sec24b UTSW 3 129996080 missense probably benign 0.00
R3121:Sec24b UTSW 3 130002304 critical splice donor site probably null
R3729:Sec24b UTSW 3 130033833 missense possibly damaging 0.95
R3789:Sec24b UTSW 3 130020627 missense probably benign 0.00
R4229:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4230:Sec24b UTSW 3 130040719 missense probably benign 0.24
R4617:Sec24b UTSW 3 130040764 missense possibly damaging 0.94
R4856:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4886:Sec24b UTSW 3 129983970 missense probably benign 0.07
R4913:Sec24b UTSW 3 130002379 missense probably benign 0.07
R5510:Sec24b UTSW 3 130040895 missense probably damaging 1.00
R5601:Sec24b UTSW 3 130040834 small insertion probably benign
R6167:Sec24b UTSW 3 129988901 missense possibly damaging 0.88
R6314:Sec24b UTSW 3 130007245 splice site probably null
R6442:Sec24b UTSW 3 129996701 missense probably damaging 1.00
R6512:Sec24b UTSW 3 130041297 missense probably damaging 1.00
R6743:Sec24b UTSW 3 130041232 missense probably damaging 0.98
R7081:Sec24b UTSW 3 129987742 missense probably benign 0.00
R7179:Sec24b UTSW 3 129988946 missense probably damaging 1.00
R7214:Sec24b UTSW 3 130033860 missense probably benign 0.19
R7332:Sec24b UTSW 3 130041393 missense probably benign 0.10
R7414:Sec24b UTSW 3 130009865 missense probably benign 0.01
R7599:Sec24b UTSW 3 130040811 small insertion probably benign
R7774:Sec24b UTSW 3 129984197 missense possibly damaging 0.88
R7895:Sec24b UTSW 3 129995949 missense probably benign 0.13
R8146:Sec24b UTSW 3 129995924 nonsense probably null
R8217:Sec24b UTSW 3 130040950 missense possibly damaging 0.94
R8344:Sec24b UTSW 3 130005001 missense probably damaging 0.97
X0065:Sec24b UTSW 3 129996355 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACACGATGATGGTTGATTTAGCC -3'
(R):5'- CTGTCTTCAGGTGCAGATTCTC -3'

Sequencing Primer
(F):5'- CATGCAAGACTAAAGCTGTC -3'
(R):5'- AGCTCCGTAGTATCCACA -3'
Posted On2015-03-18