Mutagenetix > Incidental Mutation

Incidental Mutation 'R3731:Disp3'

270976

Institutional Source

Beutler Lab

Gene Symbol

Disp3

Ensembl Gene

ENSMUSG00000041544

Gene Name

dispatched RND transporter family member 3

Synonyms

Ptchd2, G630052C06Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3731 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148240264-148287965 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148252827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 844 (S844P)

Ref Sequence

ENSEMBL: ENSMUSP00000038490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047720]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000047720
AA Change: S844P

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: S844P

Domain	Start	End	E-Value	Type
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	159	171	N/A	INTRINSIC
low complexity region	179	195	N/A	INTRINSIC
Pfam:Patched	362	735	2.2e-21	PFAM
Pfam:MMPL	366	590	3.1e-14	PFAM
Pfam:Sterol-sensing	435	588	1.1e-17	PFAM
Pfam:Patched	1121	1301	1.6e-7	PFAM
transmembrane domain	1314	1333	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	A	16: 14,609,621		probably null	Het
Abcc5	A	T	16: 20,398,934	Y5*	probably null	Het
Acbd6	T	A	1: 155,558,725	S30T	probably benign	Het
Adar	T	C	3: 89,746,655	I325T	probably damaging	Het
Akap13	T	C	7: 75,611,377	S92P	probably benign	Het
Atp1a4	A	T	1: 172,233,961	V771E	probably damaging	Het
BC030867	A	G	11: 102,257,906	E381G	possibly damaging	Het
Cfh	A	G	1: 140,119,970	S492P	possibly damaging	Het
Crlf1	A	G	8: 70,499,442	T95A	probably benign	Het
Dennd2d	T	G	3: 106,499,955	F441V	probably damaging	Het
Dhx33	T	C	11: 70,989,152	D344G	probably benign	Het
Dock2	T	C	11: 34,708,895	K286E	probably damaging	Het
Fam228a	T	C	12: 4,718,671	E203G	probably benign	Het
Fbxo38	GTGCTGCTGCTGCTGCTGCTGC	GTGCTGCTGCTGCTGCTGC	18: 62,515,328		probably benign	Het
Frmpd4	G	A	X: 167,486,807	T493M	probably damaging	Het
Galnt13	A	G	2: 54,933,507	N365S	possibly damaging	Het
Ighv1-19	C	A	12: 114,708,877	C40F	probably damaging	Het
Ints4	A	G	7: 97,506,101	Q320R	probably benign	Het
Kctd5	T	C	17: 24,059,238	D146G	probably benign	Het
Loxl3	T	C	6: 83,050,671		probably null	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrp2	A	T	2: 69,534,907		probably null	Het
Manba	G	A	3: 135,554,850	V599I	probably benign	Het
Mbd6	A	G	10: 127,285,768		probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nepn	A	T	10: 52,404,014	N401Y	probably damaging	Het
Nol10	A	T	12: 17,424,673	K622I	probably benign	Het
Npas3	T	C	12: 53,354,392	I40T	probably benign	Het
Olfr348	A	T	2: 36,786,566	I14F	possibly damaging	Het
Olfr389	T	C	11: 73,776,739	E196G	probably benign	Het
Olfr498	T	C	7: 108,465,426	I34T	possibly damaging	Het
Olfr710	T	A	7: 106,944,477	N175Y	probably damaging	Het
Olfr733	T	A	14: 50,298,505	D268V	probably damaging	Het
Olfr952	T	A	9: 39,427,069	M1L	probably benign	Het
Phtf1	A	G	3: 103,985,779	M120V	probably benign	Het
Plxna2	A	G	1: 194,788,885	Y988C	probably benign	Het
Rgs12	G	A	5: 35,032,251	E658K	probably damaging	Het
Ripor3	C	G	2: 167,992,819	E251Q	probably damaging	Het
Sec24b	T	C	3: 130,033,833	K203R	possibly damaging	Het
Serpina1d	T	A	12: 103,767,905	N47Y	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sirpb1c	T	C	3: 15,833,123	K184R	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Upp2	T	C	2: 58,755,367	S41P	probably benign	Het
Vmn1r10	A	G	6: 57,113,734	T104A	probably damaging	Het
Wdhd1	A	C	14: 47,247,892	S838R	possibly damaging	Het
Zer1	A	G	2: 30,110,911	V166A	probably benign	Het
Zfp217	T	C	2: 170,114,388	N897D	probably benign	Het
Zfp960	T	A	17: 17,088,371	L449H	probably damaging	Het

Other mutations in Disp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Disp3	APN	4	148241534	missense	probably benign	0.10
IGL01065:Disp3	APN	4	148261183	missense	probably damaging	1.00
IGL01800:Disp3	APN	4	148249801	nonsense	probably null
IGL01947:Disp3	APN	4	148260519	missense	probably damaging	1.00
IGL02510:Disp3	APN	4	148252701	missense	probably benign	0.00
IGL02573:Disp3	APN	4	148271449	missense	probably damaging	1.00
IGL02728:Disp3	APN	4	148272038	missense	probably damaging	1.00
IGL02931:Disp3	APN	4	148249201	missense	possibly damaging	0.94
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0164:Disp3	UTSW	4	148254251	missense	probably damaging	0.96
R0257:Disp3	UTSW	4	148250754	missense	possibly damaging	0.87
R0409:Disp3	UTSW	4	148271959	missense	probably damaging	1.00
R0557:Disp3	UTSW	4	148241404	missense	possibly damaging	0.64
R0576:Disp3	UTSW	4	148241590	missense	possibly damaging	0.89
R1495:Disp3	UTSW	4	148249825	missense	probably benign	0.00
R1526:Disp3	UTSW	4	148259916	missense	probably benign	0.00
R1791:Disp3	UTSW	4	148241518	missense	probably damaging	1.00
R1856:Disp3	UTSW	4	148271632	missense	probably damaging	1.00
R1987:Disp3	UTSW	4	148258753	missense	probably damaging	0.97
R2030:Disp3	UTSW	4	148259966	missense	probably damaging	1.00
R2271:Disp3	UTSW	4	148271602	missense	possibly damaging	0.87
R2373:Disp3	UTSW	4	148258795	missense	probably damaging	1.00
R2566:Disp3	UTSW	4	148241423	missense	probably damaging	1.00
R4359:Disp3	UTSW	4	148271932	missense	probably benign	0.03
R4762:Disp3	UTSW	4	148272118	missense	probably damaging	1.00
R4950:Disp3	UTSW	4	148258126	missense	possibly damaging	0.94
R4975:Disp3	UTSW	4	148244216	missense	possibly damaging	0.79
R5218:Disp3	UTSW	4	148242876	missense	possibly damaging	0.88
R5523:Disp3	UTSW	4	148258097	missense	probably benign	0.14
R5556:Disp3	UTSW	4	148258157	missense	probably benign	0.14
R5857:Disp3	UTSW	4	148249183	missense	probably benign	0.01
R5933:Disp3	UTSW	4	148241313	nonsense	probably null
R5994:Disp3	UTSW	4	148254284	missense	possibly damaging	0.94
R6362:Disp3	UTSW	4	148254308	missense	possibly damaging	0.95
R6813:Disp3	UTSW	4	148259930	missense	probably benign	0.09
R7211:Disp3	UTSW	4	148241522	missense	probably damaging	0.98
R7470:Disp3	UTSW	4	148261070	missense	possibly damaging	0.88
R7535:Disp3	UTSW	4	148242866	missense	probably damaging	0.99
R8093:Disp3	UTSW	4	148270516	missense	possibly damaging	0.93
R8357:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8457:Disp3	UTSW	4	148261115	missense	possibly damaging	0.86
R8506:Disp3	UTSW	4	148241570	missense	possibly damaging	0.77
R9182:Disp3	UTSW	4	148270384	missense	probably damaging	1.00
R9219:Disp3	UTSW	4	148249860	missense	possibly damaging	0.74
R9680:Disp3	UTSW	4	148271644	missense	probably damaging	1.00
R9696:Disp3	UTSW	4	148261154	missense	probably damaging	0.97
Z1088:Disp3	UTSW	4	148271743	missense	possibly damaging	0.63
Z1176:Disp3	UTSW	4	148250957	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249746	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148249847	missense	probably benign	0.01
Z1177:Disp3	UTSW	4	148250714	missense	probably damaging	1.00
Z1177:Disp3	UTSW	4	148270567	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCAGTCATCTTTGCCAGTG -3'
(R):5'- CAAGTTCAAAACTAAGCTTCTGAGC -3'

Sequencing Primer
(F):5'- AGTCATCTTTGCCAGTGTCCAC -3'
(R):5'- GCTTCTGAGCTCCGGGTAC -3'

Posted On

2015-03-18