Incidental Mutation 'R3731:Loxl3'
ID270982
Institutional Source Beutler Lab
Gene Symbol Loxl3
Ensembl Gene ENSMUSG00000000693
Gene Namelysyl oxidase-like 3
SynonymsLor2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83034173-83052562 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 83050671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000101257] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
Predicted Effect probably null
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Loxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Loxl3 APN 6 83048766 unclassified probably benign
IGL01370:Loxl3 APN 6 83049487 missense probably damaging 1.00
IGL02126:Loxl3 APN 6 83048647 missense probably damaging 1.00
IGL02128:Loxl3 APN 6 83050583 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R1725:Loxl3 UTSW 6 83035593 missense probably benign 0.00
R1771:Loxl3 UTSW 6 83049909 missense probably damaging 1.00
R2017:Loxl3 UTSW 6 83048977 missense probably damaging 0.99
R2291:Loxl3 UTSW 6 83037488 missense probably benign 0.07
R4179:Loxl3 UTSW 6 83037584 missense probably benign 0.00
R5230:Loxl3 UTSW 6 83035794 missense probably benign 0.16
R5385:Loxl3 UTSW 6 83050612 missense probably damaging 0.99
R5591:Loxl3 UTSW 6 83048037 missense probably damaging 1.00
R5664:Loxl3 UTSW 6 83049882 missense probably benign 0.12
R5769:Loxl3 UTSW 6 83050600 missense probably damaging 0.98
R5771:Loxl3 UTSW 6 83035799 splice site probably null
R5802:Loxl3 UTSW 6 83049289 missense possibly damaging 0.67
R5831:Loxl3 UTSW 6 83049018 missense probably benign 0.01
R5945:Loxl3 UTSW 6 83037511 missense probably damaging 1.00
R6542:Loxl3 UTSW 6 83048166 missense probably benign 0.00
R6687:Loxl3 UTSW 6 83050664 missense probably damaging 1.00
R7961:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8009:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8122:Loxl3 UTSW 6 83049259 missense probably damaging 1.00
R8278:Loxl3 UTSW 6 83048716 missense probably damaging 1.00
R8373:Loxl3 UTSW 6 83048891 missense possibly damaging 0.89
V1024:Loxl3 UTSW 6 83035738 missense probably damaging 1.00
X0009:Loxl3 UTSW 6 83038480 missense probably damaging 1.00
Z1177:Loxl3 UTSW 6 83038578 nonsense probably null
Z1177:Loxl3 UTSW 6 83048160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGCTTTCAGATGCTGGG -3'
(R):5'- TGGTTACTAGTCTGGCCAGG -3'

Sequencing Primer
(F):5'- AGTGATGAGGACACCTGTGACC -3'
(R):5'- TACTAGTCTGGCCAGGGTAGC -3'
Posted On2015-03-18