Incidental Mutation 'R3731:Ints4'
ID270986
Institutional Source Beutler Lab
Gene Symbol Ints4
Ensembl Gene ENSMUSG00000025133
Gene Nameintegrator complex subunit 4
Synonyms2610034N24Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location97480956-97541395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97506101 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 320 (Q320R)
Ref Sequence ENSEMBL: ENSMUSP00000026126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026126]
Predicted Effect probably benign
Transcript: ENSMUST00000026126
AA Change: Q320R

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133
AA Change: Q320R

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205876
AA Change: Q36R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206644
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Ints4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Ints4 APN 7 97535205 missense probably damaging 1.00
IGL01736:Ints4 APN 7 97526642 missense probably benign 0.01
IGL01862:Ints4 APN 7 97541153 missense probably damaging 1.00
IGL02277:Ints4 APN 7 97487458 missense probably damaging 1.00
IGL02396:Ints4 APN 7 97537900 missense possibly damaging 0.64
IGL02661:Ints4 APN 7 97495705 missense probably benign
IGL02750:Ints4 APN 7 97517757 critical splice donor site probably null
IGL03108:Ints4 APN 7 97490930 critical splice acceptor site probably null
R0332:Ints4 UTSW 7 97517718 missense probably damaging 1.00
R0449:Ints4 UTSW 7 97529223 missense probably damaging 0.97
R1065:Ints4 UTSW 7 97507892 critical splice donor site probably null
R1722:Ints4 UTSW 7 97513579 missense probably benign 0.24
R2060:Ints4 UTSW 7 97501763 missense possibly damaging 0.93
R2211:Ints4 UTSW 7 97509750 missense possibly damaging 0.63
R3881:Ints4 UTSW 7 97516257 missense possibly damaging 0.94
R4089:Ints4 UTSW 7 97529255 nonsense probably null
R4192:Ints4 UTSW 7 97507733 missense probably damaging 1.00
R4479:Ints4 UTSW 7 97484971 missense probably damaging 1.00
R4980:Ints4 UTSW 7 97501850 critical splice donor site probably null
R5029:Ints4 UTSW 7 97509774 missense probably benign 0.06
R5306:Ints4 UTSW 7 97509678 missense probably damaging 1.00
R6160:Ints4 UTSW 7 97509583 splice site probably null
R6317:Ints4 UTSW 7 97529218 nonsense probably null
R6961:Ints4 UTSW 7 97541190 makesense probably null
R7026:Ints4 UTSW 7 97519154 missense possibly damaging 0.50
R7156:Ints4 UTSW 7 97535286 critical splice donor site probably null
R7205:Ints4 UTSW 7 97535226 nonsense probably null
R7234:Ints4 UTSW 7 97530300 missense probably benign 0.00
R7418:Ints4 UTSW 7 97490972 missense probably benign 0.03
R7423:Ints4 UTSW 7 97507719 missense probably damaging 1.00
R7462:Ints4 UTSW 7 97506128 missense probably benign 0.11
R7658:Ints4 UTSW 7 97529253 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGACTCACTCGGCTTAACTC -3'
(R):5'- CTTGCTTAACACAACCTTTGCAAAG -3'

Sequencing Primer
(F):5'- CCAGTTACTCAGGCTGCTTAGAAG -3'
(R):5'- CAGAATGAAATTCATGATGTAGCTTG -3'
Posted On2015-03-18