Incidental Mutation 'R3731:Crlf1'
ID270989
Institutional Source Beutler Lab
Gene Symbol Crlf1
Ensembl Gene ENSMUSG00000007888
Gene Namecytokine receptor-like factor 1
SynonymsCLF-1, cytokine receptor like molecule 3, CRLM3
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70493158-70504081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70499442 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000119545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000132648] [ENSMUST00000136913]
Predicted Effect probably benign
Transcript: ENSMUST00000008032
AA Change: T217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888
AA Change: T217A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127983
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132648
AA Change: T95A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119545
Gene: ENSMUSG00000007888
AA Change: T95A

DomainStartEndE-ValueType
FN3 16 101 2.11e0 SMART
low complexity region 104 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135773
Predicted Effect probably benign
Transcript: ENSMUST00000136913
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143598
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cytokine type I receptor family. The encoded protein functions as a cytokine receptor subunit and may be involved in immune system regulation and fetal development. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation fail to suckle effectively and do not survive beyond 24 hrs after birth. Newborns exhibit reduced numbers of hematopoietic progenitor cells as well as a significant reduction in the number of motoneurons in the lumbar spinal cord and facial nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Crlf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Crlf1 APN 8 70503640 critical splice donor site probably null
R0317:Crlf1 UTSW 8 70498599 missense probably benign
R0398:Crlf1 UTSW 8 70499089 splice site probably benign
R0437:Crlf1 UTSW 8 70499514 splice site probably null
R1191:Crlf1 UTSW 8 70498828 missense probably damaging 1.00
R1741:Crlf1 UTSW 8 70500906 missense probably damaging 0.99
R3730:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R4467:Crlf1 UTSW 8 70500956 nonsense probably null
R5557:Crlf1 UTSW 8 70498667 missense probably benign 0.12
R6009:Crlf1 UTSW 8 70503479 missense probably damaging 1.00
R6348:Crlf1 UTSW 8 70493340 missense probably benign
R6606:Crlf1 UTSW 8 70501174 missense probably damaging 1.00
R7947:Crlf1 UTSW 8 70499212 missense probably damaging 1.00
X0062:Crlf1 UTSW 8 70498837 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTGAGGTTGGTACCCAG -3'
(R):5'- TGAACAACCACTGTCCTGC -3'

Sequencing Primer
(F):5'- GTGTGACTTCTGGCAATACTTAC -3'
(R):5'- ACTGTCCTGCAACCACCGTG -3'
Posted On2015-03-18