Incidental Mutation 'R3731:Olfr952'
ID270990
Institutional Source Beutler Lab
Gene Symbol Olfr952
Ensembl Gene ENSMUSG00000058856
Gene Nameolfactory receptor 952
SynonymsMOR171-21, GA_x6K02T2PVTD-33124064-33123120
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39426093-39427148 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 39427069 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000073558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073895]
Predicted Effect probably benign
Transcript: ENSMUST00000073895
AA Change: M1L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073558
Gene: ENSMUSG00000058856
AA Change: M1L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.5e-42 PFAM
Pfam:7tm_1 41 294 3.2e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Olfr952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Olfr952 APN 9 39426657 missense probably benign 0.02
IGL01368:Olfr952 APN 9 39426180 missense probably damaging 1.00
IGL01866:Olfr952 APN 9 39426729 missense probably damaging 0.99
IGL01939:Olfr952 APN 9 39426338 missense probably damaging 1.00
IGL03048:Olfr952 UTSW 9 39426769 missense probably benign 0.00
R0069:Olfr952 UTSW 9 39426892 missense probably damaging 0.98
R1460:Olfr952 UTSW 9 39426207 missense probably benign 0.43
R1478:Olfr952 UTSW 9 39426592 missense possibly damaging 0.91
R1737:Olfr952 UTSW 9 39426958 missense probably damaging 0.99
R2112:Olfr952 UTSW 9 39426670 missense probably benign 0.26
R2169:Olfr952 UTSW 9 39426358 missense possibly damaging 0.95
R2225:Olfr952 UTSW 9 39426619 missense probably benign 0.00
R3777:Olfr952 UTSW 9 39426605 missense possibly damaging 0.75
R3802:Olfr952 UTSW 9 39426286 missense probably damaging 1.00
R4600:Olfr952 UTSW 9 39426435 missense probably benign 0.27
R4887:Olfr952 UTSW 9 39426235 missense possibly damaging 0.80
R5215:Olfr952 UTSW 9 39426623 nonsense probably null
R5813:Olfr952 UTSW 9 39426736 missense probably damaging 1.00
R6140:Olfr952 UTSW 9 39426247 missense possibly damaging 0.91
R6180:Olfr952 UTSW 9 39426712 missense probably damaging 1.00
R6383:Olfr952 UTSW 9 39426234 missense probably damaging 1.00
R6416:Olfr952 UTSW 9 39426891 missense probably damaging 0.98
R6808:Olfr952 UTSW 9 39426540 missense probably damaging 0.99
R7099:Olfr952 UTSW 9 39426303 missense probably benign 0.01
R7826:Olfr952 UTSW 9 39426127 makesense probably null
R8309:Olfr952 UTSW 9 39426670 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCTTCTCTGTCACAAAGTTCAACAG -3'
(R):5'- TCTCCAGGACTGCAAAATCTC -3'

Sequencing Primer
(F):5'- GTCACAAAGTTCAACAGCATTTTAGG -3'
(R):5'- GCCAATGGTTGCAGATATC -3'
Posted On2015-03-18